ID: 1060736351

View in Genome Browser
Species Human (GRCh38)
Location 9:126068871-126068893
Sequence AGGAAGCGGACAGCACCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060736346_1060736351 3 Left 1060736346 9:126068845-126068867 CCATGGAAACCTCAGTCTTAGGC No data
Right 1060736351 9:126068871-126068893 AGGAAGCGGACAGCACCTGCAGG No data
1060736343_1060736351 26 Left 1060736343 9:126068822-126068844 CCAGCAGGGCAGGATCAGGGCAG No data
Right 1060736351 9:126068871-126068893 AGGAAGCGGACAGCACCTGCAGG No data
1060736348_1060736351 -6 Left 1060736348 9:126068854-126068876 CCTCAGTCTTAGGCCGCAGGAAG No data
Right 1060736351 9:126068871-126068893 AGGAAGCGGACAGCACCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060736351 Original CRISPR AGGAAGCGGACAGCACCTGC AGG Intergenic
No off target data available for this crispr