ID: 1060736394

View in Genome Browser
Species Human (GRCh38)
Location 9:126069064-126069086
Sequence AGATGGCAAATGGCAGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060736394_1060736405 24 Left 1060736394 9:126069064-126069086 CCTGGTTCTGCCATTTGCCATCT No data
Right 1060736405 9:126069111-126069133 CCTCCCCGAAGGACAACAGCGGG No data
1060736394_1060736400 13 Left 1060736394 9:126069064-126069086 CCTGGTTCTGCCATTTGCCATCT No data
Right 1060736400 9:126069100-126069122 CAAGTCGCCTCCCTCCCCGAAGG No data
1060736394_1060736403 23 Left 1060736394 9:126069064-126069086 CCTGGTTCTGCCATTTGCCATCT No data
Right 1060736403 9:126069110-126069132 CCCTCCCCGAAGGACAACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060736394 Original CRISPR AGATGGCAAATGGCAGAACC AGG (reversed) Intergenic
No off target data available for this crispr