ID: 1060736396

View in Genome Browser
Species Human (GRCh38)
Location 9:126069074-126069096
Sequence AAGGCCACAAAGATGGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060736396_1060736400 3 Left 1060736396 9:126069074-126069096 CCATTTGCCATCTTTGTGGCCTT No data
Right 1060736400 9:126069100-126069122 CAAGTCGCCTCCCTCCCCGAAGG No data
1060736396_1060736410 28 Left 1060736396 9:126069074-126069096 CCATTTGCCATCTTTGTGGCCTT No data
Right 1060736410 9:126069125-126069147 AACAGCGGGCCCTGCCTCTTGGG No data
1060736396_1060736403 13 Left 1060736396 9:126069074-126069096 CCATTTGCCATCTTTGTGGCCTT No data
Right 1060736403 9:126069110-126069132 CCCTCCCCGAAGGACAACAGCGG No data
1060736396_1060736405 14 Left 1060736396 9:126069074-126069096 CCATTTGCCATCTTTGTGGCCTT No data
Right 1060736405 9:126069111-126069133 CCTCCCCGAAGGACAACAGCGGG No data
1060736396_1060736409 27 Left 1060736396 9:126069074-126069096 CCATTTGCCATCTTTGTGGCCTT No data
Right 1060736409 9:126069124-126069146 CAACAGCGGGCCCTGCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060736396 Original CRISPR AAGGCCACAAAGATGGCAAA TGG (reversed) Intergenic
No off target data available for this crispr