ID: 1060736398

View in Genome Browser
Species Human (GRCh38)
Location 9:126069081-126069103
Sequence CTTGTCCAAGGCCACAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060736398_1060736411 26 Left 1060736398 9:126069081-126069103 CCATCTTTGTGGCCTTGGACAAG No data
Right 1060736411 9:126069130-126069152 CGGGCCCTGCCTCTTGGGTGTGG No data
1060736398_1060736405 7 Left 1060736398 9:126069081-126069103 CCATCTTTGTGGCCTTGGACAAG No data
Right 1060736405 9:126069111-126069133 CCTCCCCGAAGGACAACAGCGGG No data
1060736398_1060736414 30 Left 1060736398 9:126069081-126069103 CCATCTTTGTGGCCTTGGACAAG No data
Right 1060736414 9:126069134-126069156 CCCTGCCTCTTGGGTGTGGAGGG No data
1060736398_1060736403 6 Left 1060736398 9:126069081-126069103 CCATCTTTGTGGCCTTGGACAAG No data
Right 1060736403 9:126069110-126069132 CCCTCCCCGAAGGACAACAGCGG No data
1060736398_1060736409 20 Left 1060736398 9:126069081-126069103 CCATCTTTGTGGCCTTGGACAAG No data
Right 1060736409 9:126069124-126069146 CAACAGCGGGCCCTGCCTCTTGG No data
1060736398_1060736410 21 Left 1060736398 9:126069081-126069103 CCATCTTTGTGGCCTTGGACAAG No data
Right 1060736410 9:126069125-126069147 AACAGCGGGCCCTGCCTCTTGGG No data
1060736398_1060736412 29 Left 1060736398 9:126069081-126069103 CCATCTTTGTGGCCTTGGACAAG No data
Right 1060736412 9:126069133-126069155 GCCCTGCCTCTTGGGTGTGGAGG No data
1060736398_1060736400 -4 Left 1060736398 9:126069081-126069103 CCATCTTTGTGGCCTTGGACAAG No data
Right 1060736400 9:126069100-126069122 CAAGTCGCCTCCCTCCCCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060736398 Original CRISPR CTTGTCCAAGGCCACAAAGA TGG (reversed) Intergenic
No off target data available for this crispr