ID: 1060736400

View in Genome Browser
Species Human (GRCh38)
Location 9:126069100-126069122
Sequence CAAGTCGCCTCCCTCCCCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060736396_1060736400 3 Left 1060736396 9:126069074-126069096 CCATTTGCCATCTTTGTGGCCTT No data
Right 1060736400 9:126069100-126069122 CAAGTCGCCTCCCTCCCCGAAGG No data
1060736394_1060736400 13 Left 1060736394 9:126069064-126069086 CCTGGTTCTGCCATTTGCCATCT No data
Right 1060736400 9:126069100-126069122 CAAGTCGCCTCCCTCCCCGAAGG No data
1060736398_1060736400 -4 Left 1060736398 9:126069081-126069103 CCATCTTTGTGGCCTTGGACAAG No data
Right 1060736400 9:126069100-126069122 CAAGTCGCCTCCCTCCCCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060736400 Original CRISPR CAAGTCGCCTCCCTCCCCGA AGG Intergenic
No off target data available for this crispr