ID: 1060736405

View in Genome Browser
Species Human (GRCh38)
Location 9:126069111-126069133
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060736398_1060736405 7 Left 1060736398 9:126069081-126069103 CCATCTTTGTGGCCTTGGACAAG No data
Right 1060736405 9:126069111-126069133 CCTCCCCGAAGGACAACAGCGGG No data
1060736394_1060736405 24 Left 1060736394 9:126069064-126069086 CCTGGTTCTGCCATTTGCCATCT No data
Right 1060736405 9:126069111-126069133 CCTCCCCGAAGGACAACAGCGGG No data
1060736399_1060736405 -5 Left 1060736399 9:126069093-126069115 CCTTGGACAAGTCGCCTCCCTCC No data
Right 1060736405 9:126069111-126069133 CCTCCCCGAAGGACAACAGCGGG No data
1060736396_1060736405 14 Left 1060736396 9:126069074-126069096 CCATTTGCCATCTTTGTGGCCTT No data
Right 1060736405 9:126069111-126069133 CCTCCCCGAAGGACAACAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060736405 Original CRISPR CCTCCCCGAAGGACAACAGC GGG Intergenic