ID: 1060736410

View in Genome Browser
Species Human (GRCh38)
Location 9:126069125-126069147
Sequence AACAGCGGGCCCTGCCTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060736404_1060736410 -9 Left 1060736404 9:126069111-126069133 CCTCCCCGAAGGACAACAGCGGG No data
Right 1060736410 9:126069125-126069147 AACAGCGGGCCCTGCCTCTTGGG No data
1060736402_1060736410 -8 Left 1060736402 9:126069110-126069132 CCCTCCCCGAAGGACAACAGCGG No data
Right 1060736410 9:126069125-126069147 AACAGCGGGCCCTGCCTCTTGGG No data
1060736399_1060736410 9 Left 1060736399 9:126069093-126069115 CCTTGGACAAGTCGCCTCCCTCC No data
Right 1060736410 9:126069125-126069147 AACAGCGGGCCCTGCCTCTTGGG No data
1060736398_1060736410 21 Left 1060736398 9:126069081-126069103 CCATCTTTGTGGCCTTGGACAAG No data
Right 1060736410 9:126069125-126069147 AACAGCGGGCCCTGCCTCTTGGG No data
1060736396_1060736410 28 Left 1060736396 9:126069074-126069096 CCATTTGCCATCTTTGTGGCCTT No data
Right 1060736410 9:126069125-126069147 AACAGCGGGCCCTGCCTCTTGGG No data
1060736401_1060736410 -5 Left 1060736401 9:126069107-126069129 CCTCCCTCCCCGAAGGACAACAG No data
Right 1060736410 9:126069125-126069147 AACAGCGGGCCCTGCCTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060736410 Original CRISPR AACAGCGGGCCCTGCCTCTT GGG Intergenic
No off target data available for this crispr