ID: 1060736411

View in Genome Browser
Species Human (GRCh38)
Location 9:126069130-126069152
Sequence CGGGCCCTGCCTCTTGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060736401_1060736411 0 Left 1060736401 9:126069107-126069129 CCTCCCTCCCCGAAGGACAACAG No data
Right 1060736411 9:126069130-126069152 CGGGCCCTGCCTCTTGGGTGTGG No data
1060736404_1060736411 -4 Left 1060736404 9:126069111-126069133 CCTCCCCGAAGGACAACAGCGGG No data
Right 1060736411 9:126069130-126069152 CGGGCCCTGCCTCTTGGGTGTGG No data
1060736399_1060736411 14 Left 1060736399 9:126069093-126069115 CCTTGGACAAGTCGCCTCCCTCC No data
Right 1060736411 9:126069130-126069152 CGGGCCCTGCCTCTTGGGTGTGG No data
1060736408_1060736411 -9 Left 1060736408 9:126069116-126069138 CCGAAGGACAACAGCGGGCCCTG No data
Right 1060736411 9:126069130-126069152 CGGGCCCTGCCTCTTGGGTGTGG No data
1060736407_1060736411 -8 Left 1060736407 9:126069115-126069137 CCCGAAGGACAACAGCGGGCCCT No data
Right 1060736411 9:126069130-126069152 CGGGCCCTGCCTCTTGGGTGTGG No data
1060736406_1060736411 -7 Left 1060736406 9:126069114-126069136 CCCCGAAGGACAACAGCGGGCCC No data
Right 1060736411 9:126069130-126069152 CGGGCCCTGCCTCTTGGGTGTGG No data
1060736402_1060736411 -3 Left 1060736402 9:126069110-126069132 CCCTCCCCGAAGGACAACAGCGG No data
Right 1060736411 9:126069130-126069152 CGGGCCCTGCCTCTTGGGTGTGG No data
1060736398_1060736411 26 Left 1060736398 9:126069081-126069103 CCATCTTTGTGGCCTTGGACAAG No data
Right 1060736411 9:126069130-126069152 CGGGCCCTGCCTCTTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060736411 Original CRISPR CGGGCCCTGCCTCTTGGGTG TGG Intergenic
No off target data available for this crispr