ID: 1060736825

View in Genome Browser
Species Human (GRCh38)
Location 9:126071389-126071411
Sequence GAGAAGAGCCCCAAAAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060736825_1060736830 1 Left 1060736825 9:126071389-126071411 CCTGGGTTTTTGGGGCTCTTCTC No data
Right 1060736830 9:126071413-126071435 CCACTATGCCCCTGAACTTAGGG No data
1060736825_1060736828 0 Left 1060736825 9:126071389-126071411 CCTGGGTTTTTGGGGCTCTTCTC No data
Right 1060736828 9:126071412-126071434 CCCACTATGCCCCTGAACTTAGG No data
1060736825_1060736831 2 Left 1060736825 9:126071389-126071411 CCTGGGTTTTTGGGGCTCTTCTC No data
Right 1060736831 9:126071414-126071436 CACTATGCCCCTGAACTTAGGGG No data
1060736825_1060736835 24 Left 1060736825 9:126071389-126071411 CCTGGGTTTTTGGGGCTCTTCTC No data
Right 1060736835 9:126071436-126071458 GCCAGCCAGCCCCCCAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060736825 Original CRISPR GAGAAGAGCCCCAAAAACCC AGG (reversed) Intergenic
No off target data available for this crispr