ID: 1060737339

View in Genome Browser
Species Human (GRCh38)
Location 9:126074412-126074434
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060737339_1060737345 27 Left 1060737339 9:126074412-126074434 CCACGGGGGCAGTGGGAATCGGA No data
Right 1060737345 9:126074462-126074484 GTGTGAAGAGACCACCAAACAGG 0: 1170
1: 1149
2: 398
3: 94
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060737339 Original CRISPR TCCGATTCCCACTGCCCCCG TGG (reversed) Intergenic
No off target data available for this crispr