ID: 1060737343

View in Genome Browser
Species Human (GRCh38)
Location 9:126074444-126074466
Sequence CACACGGACGCACATGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060737343_1060737348 29 Left 1060737343 9:126074444-126074466 CCACTTTCATGTGCGTCCGTGTG No data
Right 1060737348 9:126074496-126074518 CAATAAAGCTTTTAATCACCTGG 0: 240
1: 81
2: 18
3: 42
4: 183
1060737343_1060737349 30 Left 1060737343 9:126074444-126074466 CCACTTTCATGTGCGTCCGTGTG No data
Right 1060737349 9:126074497-126074519 AATAAAGCTTTTAATCACCTGGG 0: 240
1: 75
2: 45
3: 26
4: 311
1060737343_1060737345 -5 Left 1060737343 9:126074444-126074466 CCACTTTCATGTGCGTCCGTGTG No data
Right 1060737345 9:126074462-126074484 GTGTGAAGAGACCACCAAACAGG 0: 1170
1: 1149
2: 398
3: 94
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060737343 Original CRISPR CACACGGACGCACATGAAAG TGG (reversed) Intergenic
No off target data available for this crispr