ID: 1060737345

View in Genome Browser
Species Human (GRCh38)
Location 9:126074462-126074484
Sequence GTGTGAAGAGACCACCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2941
Summary {0: 1170, 1: 1149, 2: 398, 3: 94, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060737339_1060737345 27 Left 1060737339 9:126074412-126074434 CCACGGGGGCAGTGGGAATCGGA No data
Right 1060737345 9:126074462-126074484 GTGTGAAGAGACCACCAAACAGG 0: 1170
1: 1149
2: 398
3: 94
4: 130
1060737343_1060737345 -5 Left 1060737343 9:126074444-126074466 CCACTTTCATGTGCGTCCGTGTG No data
Right 1060737345 9:126074462-126074484 GTGTGAAGAGACCACCAAACAGG 0: 1170
1: 1149
2: 398
3: 94
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060737345 Original CRISPR GTGTGAAGAGACCACCAAAC AGG Intergenic
Too many off-targets to display for this crispr