ID: 1060737348

View in Genome Browser
Species Human (GRCh38)
Location 9:126074496-126074518
Sequence CAATAAAGCTTTTAATCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 240, 1: 81, 2: 18, 3: 42, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060737346_1060737348 0 Left 1060737346 9:126074473-126074495 CCACCAAACAGGCTTTGTGTGAG 0: 1811
1: 754
2: 177
3: 58
4: 177
Right 1060737348 9:126074496-126074518 CAATAAAGCTTTTAATCACCTGG 0: 240
1: 81
2: 18
3: 42
4: 183
1060737343_1060737348 29 Left 1060737343 9:126074444-126074466 CCACTTTCATGTGCGTCCGTGTG No data
Right 1060737348 9:126074496-126074518 CAATAAAGCTTTTAATCACCTGG 0: 240
1: 81
2: 18
3: 42
4: 183
1060737347_1060737348 -3 Left 1060737347 9:126074476-126074498 CCAAACAGGCTTTGTGTGAGCAA 0: 1836
1: 751
2: 164
3: 55
4: 160
Right 1060737348 9:126074496-126074518 CAATAAAGCTTTTAATCACCTGG 0: 240
1: 81
2: 18
3: 42
4: 183
1060737344_1060737348 13 Left 1060737344 9:126074460-126074482 CCGTGTGAAGAGACCACCAAACA 0: 1480
1: 638
2: 165
3: 77
4: 177
Right 1060737348 9:126074496-126074518 CAATAAAGCTTTTAATCACCTGG 0: 240
1: 81
2: 18
3: 42
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060737348 Original CRISPR CAATAAAGCTTTTAATCACC TGG Intergenic
900840465 1:5045172-5045194 CAATAAAGCTTTTAATCACCTGG - Intergenic
900841631 1:5053030-5053052 CAATAAAGCTTTTAATCACCTGG - Intergenic
902809449 1:18879947-18879969 CAATAAAAATGCTAATCACCCGG + Intronic
905060833 1:35137660-35137682 CAATAAAGCTTTTAATCACCTGG + Intergenic
907295505 1:53449755-53449777 AATAAAAGCTTTTAATCACCTGG - Intergenic
907820579 1:57963852-57963874 CAATACAGCTTATAATGACACGG - Intronic
909035158 1:70588725-70588747 CAATAAAGCTTTTAATCATCTGG - Intergenic
909035951 1:70593920-70593942 CAATAAAGCTTTTAATCACCTGG - Intergenic
909223164 1:72987847-72987869 CAATAAAGCTTTTAATCACCTGG + Intergenic
909467278 1:75986439-75986461 CATTTAGGTTTTTAATCACCTGG + Intergenic
909496997 1:76289731-76289753 CAATAGAGGGTTTAATCAACAGG + Intronic
909728378 1:78864015-78864037 CAATAAAGCCTTTAGTCCACAGG - Intergenic
909787788 1:79638808-79638830 CAATAAAGCTTTTAATCATCTGG + Intergenic
909788577 1:79644129-79644151 CAATAAAGCTTTTAATCACCTGG + Intergenic
911510100 1:98801101-98801123 CCATAAAGCTTTTAATCTCCTGG + Intergenic
911510891 1:98806461-98806483 CAATAAAGCTTTTAATCTCCTGG + Intergenic
912240181 1:107898567-107898589 AAATAAAGCTTTCAATCTCTAGG + Intronic
912750977 1:112287329-112287351 CAATAAAGCTTTAAATGTCAAGG + Intergenic
914242532 1:145861487-145861509 CAATAAAGCTGTAAATGGCCGGG + Intergenic
914455697 1:147834224-147834246 CAATAAAGCTTTTAATCACCTGG - Intergenic
916297263 1:163233570-163233592 CAATAAAGCTTTTAATCACCTGG + Intronic
916802509 1:168227718-168227740 AAATAAAGCTTTAAATAACGAGG - Intronic
917288623 1:173448463-173448485 CAATAAAGCTTTTAACCACCTGG + Intergenic
918168107 1:181969985-181970007 CCAAAAACCTTTTAATCACAGGG - Intergenic
918425422 1:184404958-184404980 CAAGAAAGGTTTTAATGTCCAGG - Intronic
918934580 1:190904671-190904693 AAATAAAGCTATTAATCAAAGGG - Intergenic
919476945 1:198040923-198040945 CAATAAAGCTTTTAATCACCTGG - Intergenic
920026863 1:203005488-203005510 CAATAAAGCTCTTAATCACCTGG + Intergenic
920086686 1:203422587-203422609 CATTACAGCCTTTAATCAACTGG - Intergenic
920394692 1:205635769-205635791 TAATAAGGCTTTTAATCAGAGGG + Intergenic
921011295 1:211144140-211144162 CAATAAAACTTTTCTTGACCTGG - Intergenic
921656605 1:217746268-217746290 CAATAAAGCTTTTCCTATCCTGG - Intronic
923826285 1:237504215-237504237 CAATAAAGCTTTTAATCACCTGG + Intronic
923829683 1:237541623-237541645 CATTAAAGCTTTTAATCACCTGG + Intronic
923963279 1:239106994-239107016 CAATAAAGCTTTTAATCACCTGG - Intergenic
924180312 1:241434221-241434243 CAATAAAGCTTTTAATCACCTGG - Intergenic
924181183 1:241439814-241439836 CAGTAAACCTTTTAATCACCTGG - Intergenic
924259010 1:242210799-242210821 AATAAAAGCTTTTAATCACCTGG - Intronic
924727651 1:246685043-246685065 CAATAAAGCTTTTAATCACCTGG - Intergenic
924895640 1:248335812-248335834 CAATAAAGCTTTTAATCACCTGG + Intergenic
924896333 1:248340744-248340766 CAACAAAGCTTTTAATCACCTGG + Intergenic
1063715409 10:8521740-8521762 CAATAAACATTTTGATTACCAGG - Intergenic
1063950495 10:11217846-11217868 AGAAAAAGCTTTTATTCACCAGG + Intronic
1065046491 10:21751419-21751441 CAATAAAGCTTTTAATCACCTGG + Intergenic
1065455452 10:25902435-25902457 CAATAAAGCTTTTAATCACCTGG + Intergenic
1066304766 10:34129817-34129839 AAAAAAAGTTTTTAATTACCCGG - Intronic
1068168222 10:53358859-53358881 CAATAAAGCTTTTAATCACCTGG + Intergenic
1068851441 10:61746521-61746543 CAACAAAGCTTTAATTCACTGGG - Intronic
1071217941 10:83429560-83429582 CAATAAAGCTTTTACTCACCTGG + Intergenic
1071590225 10:86865531-86865553 AATAAAAGCTTTTAATCACCTGG - Intronic
1071924056 10:90384893-90384915 CAATAAAGCTTTTAATCACCTGG - Intergenic
1071960775 10:90807669-90807691 CAATACAGCTTTTAATCACCTGG - Intronic
1071961626 10:90813190-90813212 CAATACAGCTTTTAATCACCTGG - Intronic
1072010792 10:91301396-91301418 CAATAAAGCTTTTAATCAGCTGG + Intergenic
1072011619 10:91306968-91306990 CAATAAAGCTTTTAATCAACTGG + Intergenic
1073132777 10:101201049-101201071 CAATAAAACTTTTAATCACCTGG + Intergenic
1073523029 10:104152588-104152610 AAGTAAAGCTTTTATTTACCTGG + Exonic
1074174752 10:110986936-110986958 CAGCAAAACTTTTAATCACTTGG - Intronic
1074740455 10:116481015-116481037 CAATAAAGCTTTTAATCACCTGG - Intergenic
1074741281 10:116486450-116486472 CAATAAAGCTTTTAATCACCTGG - Intergenic
1075603023 10:123784588-123784610 AAATAAATCCTTCAATCACCTGG + Intronic
1076079966 10:127570442-127570464 CTATAAAACATTTAAACACCAGG + Intergenic
1077611861 11:3648238-3648260 CAATAAAGCTTTTAATCACCTGG - Intronic
1077765899 11:5160343-5160365 CAATAAAGCTTTTTATCACCTGG + Intronic
1079727407 11:23892572-23892594 CAATAAAGCTTTTAATCACCTGG + Intergenic
1079975738 11:27089731-27089753 CAATAAATCTTTTAATGTTCTGG + Intronic
1080027410 11:27629118-27629140 CAATAAAGCTTTTAATCACCTGG + Intergenic
1080028251 11:27634525-27634547 CAATAAAGCTTTTAATCACCTGG + Intergenic
1083543207 11:63529365-63529387 CAATAAAGCTTTTAATCACCTGG + Intergenic
1084355048 11:68632728-68632750 CAGTAAAGCTTTTAATCACCTGG - Intergenic
1084355243 11:68634102-68634124 CAATAAAGCTTTTAATCACCTGG - Intergenic
1084356048 11:68639371-68639393 CAATAAAGCTTTTAATCACCTGG - Intergenic
1085236975 11:75022830-75022852 CAATAAAGTTTTGATCCACCTGG - Intergenic
1085858067 11:80198335-80198357 AATAAAAGCTTTTAATCACCTGG + Intergenic
1087098792 11:94346055-94346077 CAATAAAGCTTTTAATCACCTGG - Intergenic
1087099572 11:94351352-94351374 CAATAAAGCTTTTAGTCACCTGG - Intergenic
1087100147 11:94355466-94355488 CAATAAGGCTTTTAATCACCTGG - Intergenic
1087127492 11:94641941-94641963 CAATAAAGCTTTTAATCACCTGG - Intergenic
1087128299 11:94647243-94647265 CAATAAAGCTTTTAATCACCTGG - Intergenic
1087839043 11:102904046-102904068 CAATAAAGCTTTTAATCACCTGG + Intergenic
1087839862 11:102909547-102909569 CAATAAAGCTTTTAATCACCTGG + Intergenic
1089470573 11:118717080-118717102 CAATAAAGCTTTTAATCACTTGG + Intergenic
1089472401 11:118731492-118731514 CAATAAAGCTTCTAATCACCTGG + Intergenic
1089952940 11:122546957-122546979 CAATAAAGCTTTTAATCACCTGG - Intergenic
1089954201 11:122555534-122555556 CAATAAAGCGTTTAATCACCAGG - Intergenic
1089987078 11:122824762-122824784 CAATAAAGCTTTTAATCACCTGG - Intergenic
1089988153 11:122832754-122832776 CAATAAAGCTTTTAATCACCTGG - Intergenic
1090798839 11:130158403-130158425 TCATAAAGCTTTTCATCCCCTGG - Intergenic
1091183336 11:133627117-133627139 CAATAAAGCTTTTAATCACCTGG - Intergenic
1091184189 11:133632624-133632646 CAATAAAGCTTTTAATCACCTGG - Intergenic
1092474156 12:8805213-8805235 CAATAAAGCTTTTAATCACCTGG - Intergenic
1092474963 12:8810508-8810530 CAATAAAGCTTTTAATCACCTGG - Intergenic
1092475223 12:8813265-8813287 CAATAAAGCTTTTAATCACCTGG - Intergenic
1092924300 12:13259685-13259707 CAATAAAGCTTTTAATCACCTGG + Intergenic
1092925125 12:13265166-13265188 CAATAAAGCTTTTAATCACCTGG + Intergenic
1093321498 12:17720298-17720320 CAATAAAGCTTTTAATCACCTGG + Intergenic
1093358270 12:18196090-18196112 CAATAAAGCTTTTAATCATCTGG - Intronic
1093359338 12:18203659-18203681 CAATAAAGCTTTTAATCACCTGG - Intronic
1094315483 12:29134657-29134679 CAATAAAGCTTTTAATCACCTGG + Intergenic
1094329436 12:29275113-29275135 CAATAAAGCTTTTAATCATCTGG + Intronic
1094797402 12:33991957-33991979 GAAAAAAGCTTTAAATCAACAGG + Intergenic
1097309937 12:58107631-58107653 CAATAAAGTTTCGATTCACCAGG + Intergenic
1097541598 12:60951314-60951336 CAATAAAGCTTTTAATCACCTGG + Intergenic
1097542498 12:60957261-60957283 CAATAAAGCTTTTAATCACCTGG + Intergenic
1098591151 12:72215053-72215075 CAATAAAGTTTTTAATCACCTGG + Intronic
1098841600 12:75484551-75484573 CAATAAAGCTTTTTATCACCTGG + Intronic
1099109895 12:78545566-78545588 CAATAATACTTGTAATCACATGG - Intergenic
1099283131 12:80678128-80678150 CAATAAATCTGTTAGTCACCTGG - Intronic
1100399962 12:94220882-94220904 AAATAAAGCTTTTTGTCTCCTGG - Intronic
1100939984 12:99715521-99715543 CAATAAAGCTTTTAATCACCTGG - Intronic
1100940895 12:99721669-99721691 CAATAAAGCTTTTAATCACCTGG - Intronic
1101232086 12:102751943-102751965 TAATATAGATATTAATCACCTGG + Intergenic
1101582692 12:106057220-106057242 CAATAAATCTATAAATCATCTGG - Intergenic
1101593417 12:106141928-106141950 CAATAAAGCTTTTAATCACCTGG + Intergenic
1102604174 12:114056103-114056125 CAATAAAGTTTTTAATCACCTGG - Intergenic
1103743123 12:123104731-123104753 CAATAAAGCTTTTAATCACCTGG - Intronic
1106212118 13:27659262-27659284 CCTTAAAGTTTTTAATCCCCTGG + Intronic
1106363551 13:29055046-29055068 CAATAACGCTATCAATCAACTGG - Intronic
1107185548 13:37515172-37515194 TCAAAAAGCTTTCAATCACCTGG - Intergenic
1107326948 13:39254462-39254484 CAATGAGACTTTTCATCACCTGG + Intergenic
1108050038 13:46425840-46425862 CAATGCAGCTTCTAACCACCAGG + Intronic
1108202361 13:48056696-48056718 CAATAAAGCTTTTAATCACCTGG - Intronic
1108203223 13:48062221-48062243 CAATAAAGCTTTTAATCACCTGG - Intronic
1108912924 13:55578274-55578296 CAATAAAGCTTTTAATCACCTGG + Intergenic
1108913746 13:55583684-55583706 CAATAAAGCTTTTAATCACCTGG + Intergenic
1108952316 13:56110361-56110383 CAATAAAGCATTTAATCACCTGG - Intergenic
1110649985 13:77933269-77933291 CAATAAAGCTTTTAATCACCTGG + Intergenic
1110650824 13:77939026-77939048 CAATAAAGCTTTTAATCACCTGG + Intergenic
1110671514 13:78185553-78185575 AAATAGTGCTTTTATTCACCTGG + Intergenic
1110765971 13:79279753-79279775 CAATAAAGCTTTTAATCACCTGG - Intergenic
1110845907 13:80189911-80189933 CAATAAAGCTTTTAATCACCTGG - Intergenic
1110978143 13:81866436-81866458 CAATAAAGCTTTTAATCACCTGG - Intergenic
1110979033 13:81872363-81872385 CAATAAAACTTTTAATCACCTGG - Intergenic
1110994306 13:82086407-82086429 CAATAAATTTTTTATTTACCAGG + Intergenic
1111091827 13:83456651-83456673 CAAAACAGGTTTTAAACACCTGG + Intergenic
1111361615 13:87186495-87186517 CAATAAAGCTTTTAATCACCTGG + Intergenic
1111362422 13:87191746-87191768 AAATAAAGCTTTTAATCACCTGG + Intergenic
1112280868 13:98061900-98061922 AATAAAAGCTTTTAATCACCTGG + Intergenic
1112888791 13:104207636-104207658 CAATAAAGCTTTTAATCACCTGG + Intergenic
1112889647 13:104213468-104213490 CAATAAAGCTTTTAATCACCTGG + Intergenic
1113051828 13:106220850-106220872 CTAGAAAGCTTTAAATCACCTGG - Intergenic
1113390973 13:109896644-109896666 CAATAAAACTTTTAATTGCAAGG + Intergenic
1115078720 14:29423438-29423460 CAATAAAGTTATTGATGACCAGG - Intergenic
1115904464 14:38191015-38191037 CAATAAAGCTTTTAATCACCTGG - Intergenic
1115905311 14:38196459-38196481 CAATAAAGCTGTTAATCACCTGG - Intergenic
1116185796 14:41599716-41599738 AATAAAAGCTTTTAATCACCTGG + Intergenic
1117447647 14:55820152-55820174 CAACAAAGCTTTTTATCATTTGG + Intergenic
1117801657 14:59449717-59449739 CAATAAAGCTTTTAATCACCTGG - Intronic
1118583019 14:67323880-67323902 TAATGTAGCTTTTAAGCACCAGG - Intronic
1118866453 14:69708153-69708175 CAATAAAGCTGTTAAAAAACAGG - Intronic
1119022083 14:71124546-71124568 CAATAAAGCTTTTAATCACCTGG - Intergenic
1119022893 14:71129938-71129960 CAATAAAGCTTTTAATCACCTGG - Intergenic
1119940312 14:78633725-78633747 CAAACAGGGTTTTAATCACCTGG + Intronic
1119951809 14:78752830-78752852 GAATAAAGCTCCTAATGACCAGG - Intronic
1120141772 14:80937782-80937804 TAATATAGTTTTTAATAACCTGG + Intronic
1120305108 14:82760199-82760221 CAATAAAGCTTTTAATCACCTGG + Intergenic
1120437574 14:84500296-84500318 CAATAAAGCTTTTAATCACCTGG + Intergenic
1120438375 14:84505611-84505633 CAATAAAGCTTTTAATCACCTGG + Intergenic
1120618002 14:86731928-86731950 CAATAAAGCTTTTAATCACCTGG - Intergenic
1120618725 14:86736992-86737014 CAATAAAGCTTTTAATCACCTGG - Intergenic
1121703338 14:95973362-95973384 CAATAAACCTTTTAATCACCTGG - Intergenic
1121704171 14:95978792-95978814 CAATAAACCTTTTAATCACCTGG - Intergenic
1122040691 14:98985616-98985638 CAATAAAGCTTTTAATCACCTGG - Intergenic
1122041784 14:98992871-98992893 CAATAAAGCTTTTAATCACCTGG - Intergenic
1123207780 14:106730004-106730026 AAATAAAGCTTCTACTCAGCTGG + Intergenic
1124879153 15:33625584-33625606 AAAAAAACATTTTAATCACCTGG + Intronic
1125839069 15:42781243-42781265 AAACAAAACTTTTAATCACCTGG + Intronic
1125953074 15:43770374-43770396 GAATAAAGCTTGTAACCACCAGG + Intronic
1126865343 15:52931174-52931196 CATTAAAGCTTTTCATCATTTGG + Intergenic
1128418749 15:67471586-67471608 CAATAAACCTTTTCATCAGAAGG - Intronic
1131541403 15:93278419-93278441 CAATAAAGCTTTTAATCACCTGG + Intergenic
1131685242 15:94760308-94760330 CAAGAAAGCTTTTAATCACCTGG - Intergenic
1133651081 16:7815026-7815048 CAATAAAGCTTTTAATCACCTGG - Intergenic
1133651879 16:7820329-7820351 CAATAAAGCTTTTAATCACCTGG - Intergenic
1133868988 16:9670576-9670598 CAATAAAGCTTTTAATCACCTGG + Intronic
1133869930 16:9676868-9676890 CAATAAAGCTTTTAATCACCTGG + Intergenic
1137298437 16:47121381-47121403 CATTAAACCTTTGAGTCACCTGG - Intronic
1137302662 16:47167677-47167699 CAATAAAGCTTTTAATCACCTGG - Intronic
1137405425 16:48185198-48185220 AAATCAAGCTTTTAATCTCTTGG - Intronic
1138758220 16:59514957-59514979 CAATAAAGCTTTTAATCACCTGG + Intergenic
1138759349 16:59522575-59522597 CAATAAAGCTTTTAATCACCTGG + Intergenic
1139066583 16:63323086-63323108 CACTGAAACTTTTAATAACCAGG + Intergenic
1139134814 16:64189562-64189584 AATTAAAGCTTTTGATCAGCAGG - Intergenic
1143581166 17:7827374-7827396 CATTTAAGTTTTTAATCACTTGG + Intronic
1145024582 17:19458380-19458402 CAATAAAGCTTTTAATCACCTGG + Intergenic
1145926478 17:28650938-28650960 CCAAAAAACTTTTAATTACCTGG - Intronic
1145967490 17:28930406-28930428 CAATAAAGCTTTAAAGAACTGGG + Intronic
1146905741 17:36616879-36616901 CAAAAACGTTTTTAATCAGCTGG - Intergenic
1149232672 17:54553887-54553909 CAATGAAGCTTTGTAGCACCTGG + Intergenic
1149628184 17:58095298-58095320 CAATAAAACTTTTAAAAAGCAGG + Exonic
1153082399 18:1243018-1243040 AAATATATCTTTTAATCACCAGG + Intergenic
1153609940 18:6873901-6873923 GAATAAAGCTGAAAATCACCAGG - Intronic
1153721224 18:7905470-7905492 CAATAAAGCTATGAATCAAGAGG - Intronic
1154957427 18:21272753-21272775 CAGTTCATCTTTTAATCACCAGG + Intronic
1155574802 18:27232637-27232659 CAATAAAGCTTTTAATCACCTGG - Intergenic
1155720021 18:29000396-29000418 CAATAAAGCTTTTAATCACCTGG + Intergenic
1156901467 18:42305268-42305290 CAATAAAGCTTTTAAACCACAGG + Intergenic
1156923543 18:42552487-42552509 CAATAAACCTTTTAATCACCTGG + Intergenic
1156924340 18:42557739-42557761 CAATAAAGCTTTTAATCACCTGG + Intergenic
1156939205 18:42744232-42744254 CAATAAAGCTTTTAATCACCTGG - Intronic
1156957991 18:42991889-42991911 CAATAAAGCTTTTAATCACCTGG - Intronic
1156958707 18:42996741-42996763 CAATAAAGCTTTTAATCACCTGG - Intronic
1157148162 18:45187444-45187466 CAATAAAGGTTTTAATCTGGGGG + Intergenic
1157905907 18:51570109-51570131 CAATAAATCTTTTAATCACCTGG + Intergenic
1158336029 18:56415815-56415837 CAATAAAGCTTTTAATCACCTGG - Intergenic
1158336858 18:56421273-56421295 CAATAAAGCTTTTAATCACCTGG - Intergenic
1160671971 19:369646-369668 AATAAAAGCTTTTAATCGCCTGG + Intronic
1162266805 19:9582574-9582596 CAATAAAGCTTTTAATCACCTGG - Intronic
1163487001 19:17593855-17593877 CAATAAAGCTTTTAATCACCTGG - Intergenic
1163896031 19:20059989-20060011 AATAACAGCTTTTAATCACCTGG - Intergenic
1163897100 19:20068855-20068877 AATAAAAGCTTTTAATCACCTGG + Intergenic
1163899290 19:20087733-20087755 CAATAAAGCTTTTGATCACCTGG + Intronic
1166013164 19:39959009-39959031 AATAAAAGCTTTTAATCACCTGG - Intergenic
1166396779 19:42447004-42447026 CAATAAAGCTTTTAATCACCTGG + Intergenic
1166635012 19:44443329-44443351 TAATAAAGCTTTTCCTCTCCAGG - Intronic
1167084069 19:47297089-47297111 CAATAAAGCTTTTAATCACCTGG - Intronic
1167901842 19:52628124-52628146 CAATAAAACTTTATTTCACCTGG - Intronic
1168131288 19:54321293-54321315 CAGTAAAGCTTTTAATCACCTGG + Intergenic
1168227500 19:55006875-55006897 CAATAAAGCTTTTAATCACCTGG + Intergenic
1168228287 19:55012062-55012084 CAATAAAGCTTTTAATCACCTGG + Intergenic
926457400 2:13083782-13083804 TAAAAAAGCTTTTAATGACTTGG + Intergenic
927424790 2:22970240-22970262 AATAAAAGCTTTTAATCACCTGG + Intergenic
928779219 2:34801045-34801067 CAATAAAGCTTTATTTCACCTGG + Intergenic
929076185 2:38080848-38080870 CAATAAAGCTTTTAATCACCTGG + Intronic
929077011 2:38086161-38086183 CAATAAAGCTTTTAATCACCTGG + Intronic
929413015 2:41718415-41718437 CAATACAGCTTAAAATCAACGGG - Intergenic
930113415 2:47698327-47698349 CAATAATGCTTTTAATTACCTGG + Intronic
930233663 2:48868301-48868323 CCATAAAGCTGTTTATCAGCTGG + Intergenic
930487617 2:52027237-52027259 CAATAAAGCTTTTAATCACCTGG + Intergenic
930952407 2:57158443-57158465 CAATCCAGTTTTTAATCAGCTGG - Intergenic
931608405 2:64074855-64074877 CAATAAAGCTTTTAATTACCTGG + Intergenic
931625442 2:64252827-64252849 CAATAAAGCTTTTAATCTCCTGG - Intergenic
931626186 2:64257578-64257600 CAATAAAGCTTTTAATCACCTGG - Intergenic
931947931 2:67331846-67331868 CAATAAAGCTTTTAATCACCTGG - Intergenic
931948764 2:67337533-67337555 CAATAAAGCTTTTAATCACCTGG - Intergenic
932296343 2:70626341-70626363 CAATAAAGCTTTTAATCACCTGG - Intronic
932802551 2:74754312-74754334 CAATAGAGGTTTAATTCACCAGG + Intergenic
933120717 2:78533743-78533765 CAAAAAAGATTTTAATCCACAGG + Intergenic
934904978 2:98192273-98192295 CAATAAAGCTTTTAATCACCTGG + Intronic
936555544 2:113495545-113495567 CCATAAAGCATTTAATGAACTGG + Intronic
939370468 2:141292550-141292572 CGATATAGACTTTAATCACCCGG - Intronic
939788019 2:146540223-146540245 AATAAAAGCTTTTAATCACCTGG - Intergenic
940529867 2:154867655-154867677 AATAAAAGCTTTTAATCACTTGG - Intergenic
940530899 2:154874491-154874513 AATAAAAGCTTTTAATCACCTGG - Intergenic
940532521 2:154896808-154896830 CAATTTAGCTGTTAATCAACAGG + Intergenic
940726669 2:157343115-157343137 CAATAAACTTTTTAATCACCTGG + Intergenic
941091798 2:161185416-161185438 CAGTCAAGCTTTTAACCACGTGG - Intronic
941263749 2:163332623-163332645 AAATAAATCTTTTAATTGCCAGG + Intergenic
941455275 2:165707598-165707620 CAATAAAGTTTTTAATCACCTGG + Intergenic
941456487 2:165715764-165715786 CAATAAAGCTTTTAATCACCTGG + Intergenic
941935354 2:170977504-170977526 CAATAAAGCCTTTAATCACCTGG + Intergenic
941936204 2:170983032-170983054 CAATAAAGCGTTTAATCACCTGG + Intergenic
942097667 2:172548690-172548712 CAATAAAGCTTTTAATCACCTGG - Intergenic
942623664 2:177875948-177875970 CAATAAAGCTTTAATTGACCTGG - Intronic
943104770 2:183530286-183530308 CAATAAAGCTTTTAATCACCTGG - Intergenic
943286088 2:186002736-186002758 CTATCTAGCTTTGAATCACCAGG - Intergenic
943421092 2:187670529-187670551 CAATATAGCTTTTAATCACTTGG + Intergenic
943467944 2:188253434-188253456 CAATAGAGCTTCGAAACACCTGG + Intergenic
943476360 2:188361719-188361741 CTATTCAGCTTTTAATGACCTGG + Intronic
943865100 2:192918653-192918675 CCATAAAGCTTTTAATCACCTGG - Intergenic
944731575 2:202522667-202522689 CAAAAAAAGTTTTAATCAGCTGG + Intronic
945360814 2:208894099-208894121 CAATAAAGCTTTTAATCACCTGG - Intergenic
945362177 2:208905399-208905421 CAATAAAGCTTTTAATCACCTGG - Intergenic
945394790 2:209304864-209304886 CAATAAAGCTTTTAATCACCTGG - Intergenic
945858695 2:215095961-215095983 CAATAAAGCTTTTAATCACCTGG - Intronic
946677086 2:222171644-222171666 CAAGAAAGCTTTGCATCATCTGG + Intergenic
946886991 2:224230918-224230940 CAATAAAGCTTTTAATCACCTGG - Intergenic
946985591 2:225269136-225269158 GAATAAAGATTTAAATCAACAGG + Intergenic
947184681 2:227444530-227444552 CAATAAAGCTTTCAATCACCTGG + Intergenic
947436984 2:230081213-230081235 CAAGGAAGCCTTTAAGCACCTGG - Intergenic
947531287 2:230910191-230910213 CGATAAAGCTGTTTCTCACCAGG + Exonic
947617879 2:231569822-231569844 GATAACAGCTTTTAATCACCTGG - Intergenic
948326658 2:237127229-237127251 CAATAAAACTTTTGCTCCCCTGG - Intergenic
1169520845 20:6371438-6371460 GAATAAAGCTTTTTATCTTCAGG + Intergenic
1169798615 20:9492825-9492847 CACTACGGCTTTTAAACACCTGG - Intergenic
1169954277 20:11084056-11084078 CCATGAAGCATTTAATCACCAGG + Intergenic
1169991705 20:11511906-11511928 TAATGAAACTTTGAATCACCTGG + Intergenic
1170105783 20:12753324-12753346 CAATAAAGCTTTTAATCACCTGG - Intergenic
1170807378 20:19644339-19644361 CAATAAACCCTTGAGTCACCTGG + Intronic
1171265098 20:23765108-23765130 CAATAAAGCTTTTAATCACCTGG - Intergenic
1171414680 20:24969615-24969637 CAATAAAACTTTTACTTCCCTGG + Exonic
1172926874 20:38545770-38545792 AAATATGGCTTTTAAACACCAGG + Intronic
1175494134 20:59402225-59402247 CTCTAAAGCTTTTCATCACCGGG + Intergenic
1176336043 21:5601171-5601193 AATAAAAGCTTTTAATCACCTGG + Intergenic
1176391714 21:6219777-6219799 AATAAAAGCTTTTAATCACCTGG - Intergenic
1176469705 21:7096397-7096419 AATAAAAGCTTTTAATCACCTGG + Intergenic
1176493266 21:7478175-7478197 AATAAAAGCTTTTAATCACCTGG + Intergenic
1176507376 21:7660208-7660230 AATAAAAGCTTTTAATCACCTGG - Intergenic
1177080325 21:16631384-16631406 CAATAAAGATTTTAATCACCTGG - Intergenic
1177119248 21:17121823-17121845 CAATAAAGCTTTTAATCACCTGG - Intergenic
1177488318 21:21788270-21788292 CAATAAAGCTTCTAGTCAAAAGG - Intergenic
1178563695 21:33663593-33663615 AAAAAAAGAATTTAATCACCAGG - Intronic
1182364510 22:29769166-29769188 CTATGATGCTTTCAATCACCAGG - Intronic
1182398449 22:30055031-30055053 CAGTAAAGCATTAAATCAGCAGG - Intergenic
950629420 3:14272383-14272405 CAGTAAAGCTTTTAATCACCTGG + Intergenic
950926168 3:16744612-16744634 CAATAAAGCTTTTAATCACCTGG - Intergenic
950926989 3:16749996-16750018 CAATAAAGTTTTTAATCACCTGG - Intergenic
952343822 3:32466556-32466578 CAATAAAGCTTTTAATCACCTGG + Intronic
952563120 3:34619494-34619516 CAATAAAGATTTAAATATCCAGG - Intergenic
952894697 3:38070543-38070565 AATAAAAGCTTTTAATCACCTGG + Intronic
953862539 3:46557428-46557450 CAATAAAGCTTTTAATCACCTGG - Intronic
955253089 3:57304194-57304216 CAATAAAGCTTTTAATCACCTGG - Intronic
955381362 3:58440963-58440985 CAATAAAGCTTTTAATCACCTGG + Intergenic
956358303 3:68418189-68418211 CAATAAAGCTTTTAATCACCTGG + Intronic
956696876 3:71925902-71925924 AATAAAAGCTTTTAATCACCTGG - Intergenic
957127198 3:76176948-76176970 GAATAAAGCTTTTAATAATAAGG - Intronic
957338418 3:78861469-78861491 CAGTGAAGCTTTTAAACCCCAGG - Intronic
958889538 3:99768234-99768256 CAATCAAGCTCCAAATCACCTGG + Intronic
958936707 3:100263052-100263074 CAATAAAGCTTTTAATCACCTGG + Intronic
959485276 3:106922815-106922837 CAATAAAGCTTTTAATCACCTGG + Intergenic
959486067 3:106928029-106928051 CAATAAAGCTTTTAATCACCTGG + Intergenic
959688761 3:109176448-109176470 CAATAAAGCTTTTAATCACCTGG + Intergenic
959970133 3:112400130-112400152 CAATAAAGGTTTTAATCACCTGG - Intergenic
963058274 3:141205238-141205260 CAATAAAGCTTTTAATCACCTGG - Intergenic
963059276 3:141211661-141211683 CAATAAAGCTTTTAATCACCTGG - Intergenic
963424923 3:145113402-145113424 CAATAAAGCTTTTAATCACCTGG - Intergenic
963522129 3:146367905-146367927 CAATAAAGCTTTTAATCACTTGG - Intergenic
963799958 3:149666052-149666074 CAATAAATGTTTTAATCAGGTGG - Intronic
964124899 3:153226196-153226218 CAATAAAGCTTTTAATCACCTGG + Intergenic
964125806 3:153232157-153232179 CAATAAAGCTTTTTATCACCTGG + Intergenic
964906057 3:161721961-161721983 CAATAAAGCTTTAAATCACCTGG + Intergenic
964906876 3:161727417-161727439 CAATAAAGCTTTTAATCACCTGG + Intergenic
964984452 3:162722864-162722886 CAATAAAGCTTTTAATCACCTGG + Intergenic
965104757 3:164342227-164342249 CAACAAAGCTTTTAATCACCCGG + Intergenic
965105527 3:164347487-164347509 CAATAAAGCTTTTAATCACCTGG + Intergenic
965468930 3:169066011-169066033 AAATATACCTTGTAATCACCTGG - Intergenic
965626659 3:170688853-170688875 CAATAAAGCTTTCAATCATCTGG + Intronic
965640373 3:170823402-170823424 CAATAAAGCTTTTAATCACCTGG + Intronic
965772540 3:172196115-172196137 CACTAAAGCTTTTAATTGCTGGG + Intronic
966012456 3:175097640-175097662 CATTAAAGTTTTTAATCATATGG - Intronic
966066485 3:175827865-175827887 AATAAAAGCTTTTAATCACCTGG - Intergenic
966067716 3:175836152-175836174 CATAAAAGCTTTTAATCACCTGG - Intergenic
967151814 3:186658102-186658124 CAATAAATCTTTTAATCACCTGG - Intergenic
967152613 3:186663622-186663644 CAATAAAGCTTTTAATCACCTGG - Intronic
967443081 3:189531477-189531499 CAATAAAGCTTTTAATCTCTTGG + Intergenic
967495925 3:190144939-190144961 CAATAAAGCTTTTAATCACCGGG - Intergenic
967496718 3:190150134-190150156 CAATAAAGCTTTTAATCACCTGG - Intergenic
967644142 3:191900748-191900770 CAATAAAGCTTTTGATCACCTGG + Intergenic
967740950 3:193001320-193001342 CAATAAAGCTTTTAATCATCTGG - Intergenic
969339041 4:6528946-6528968 CAACAAAGCTTTTAATCACCTGG - Intronic
970041803 4:11806675-11806697 CAATAAAACTTTTAATCACCTGG - Intergenic
970042539 4:11811870-11811892 CAATAAAGCTTTTAATCACCTGG - Intergenic
970853511 4:20629817-20629839 CAATAAAGCTTTTAATCACCTGG + Intergenic
970854359 4:20635615-20635637 CAATAAAGCTTTTAATCACCTGG + Intergenic
971122794 4:23722919-23722941 CAATAAAGCTTTTAATCACCTGG + Intergenic
971123526 4:23727466-23727488 CAATAAAGCTTTTAATCACCTGG + Intergenic
971713749 4:30149841-30149863 CAATAAAGCTTTTAATCACCTGG - Intergenic
971713886 4:30150919-30150941 CAATAAAGCTTTTAATCACTTGG - Intergenic
972509110 4:39751046-39751068 CAATAAAGAATTTAATCTTCAGG - Intronic
972721335 4:41702093-41702115 CAATAGAGCCATTAATCATCAGG + Intergenic
973881791 4:55280396-55280418 CAGTAAAGCTTCTAATCACCTGG + Intergenic
974323043 4:60376985-60377007 CACTGAAGCTTTTAATCCCTGGG + Intergenic
974593412 4:63984982-63985004 CAATAAAGCTTTTAATCACCTGG + Intergenic
975618041 4:76267048-76267070 CTATATAACTTATAATCACCCGG + Intronic
975636613 4:76456757-76456779 CAATAAAGCTTTTAATCACCTGG + Intronic
975936118 4:79582895-79582917 CAACAAGGATTTTAATGACCAGG + Intergenic
976087508 4:81421175-81421197 CAATAAAGCTTTTAATCACCTGG - Intergenic
976696215 4:87922184-87922206 CAATAAAGCTTTTAATCACCTGG - Intergenic
976697669 4:87935968-87935990 CAATAAAGCTTTTAATCACCTGG + Intergenic
977206114 4:94166888-94166910 CAATAAAGTTTTTAATCACCTGG + Intergenic
978303475 4:107295522-107295544 CAATAAAGATTTTAATCACCTGG + Intergenic
979850636 4:125567054-125567076 CAATAAAGCTTTTAATCACCTGG + Intergenic
980002840 4:127511084-127511106 CAATAAAGCTTTTAATCACCTGG + Intergenic
980003655 4:127516800-127516822 CAGTAGAGCTTTTAATCACCTGG + Intergenic
980111422 4:128640940-128640962 CAATAAAGCTTTTAATCACCTGG + Intergenic
980471911 4:133263609-133263631 CAATAAAGCTTTTAATCACATGG + Intergenic
980527574 4:134012552-134012574 CAATAAAGCTTTTAATCACCTGG - Intergenic
980528405 4:134018312-134018334 CAATAAAGCTTTTAATCACCTGG - Intergenic
980592901 4:134914642-134914664 CAATAAAGCTTTTAATCACCTGG - Intergenic
980861157 4:138500920-138500942 AAATAAAGCTCTTCATAACCTGG + Intergenic
981040729 4:140219125-140219147 CAATAAAGCTTTTAATCACCTGG - Intergenic
981524821 4:145699204-145699226 CAATAAAGCTTTTAATCACCTGG - Intronic
981525545 4:145703435-145703457 CAATAAAGCTTTTAATCACCTGG - Intronic
982397033 4:154924201-154924223 CAATAAAGCTTTTAATCATCTGG + Intergenic
982497445 4:156108943-156108965 CAATAAAGCTTTTAATCACCTGG + Intergenic
982770691 4:159394551-159394573 CAATAAAGCTTTCAATTTCATGG - Intergenic
983447758 4:167876641-167876663 CAATAAATCTTTTAAACACCTGG - Intergenic
983448542 4:167881953-167881975 CAATAAAGCTTTTAATCACCTGG - Intergenic
983460314 4:168018640-168018662 CAATAAAGCTTTTAATCACCTGG + Intergenic
983659268 4:170116770-170116792 CAATAAAGCTTTTAATCACCTGG - Intergenic
983660050 4:170122090-170122112 CAATAAAGCTTTTAATCACCTGG - Intergenic
985389390 4:189479585-189479607 CAATAAAGCTTTTAATCACCTGG + Intergenic
986019528 5:3788421-3788443 AATAAAAGCTTTTAATCACCTGG + Intergenic
986388461 5:7262674-7262696 CAATAAAGCTTTTAATCACCTGG - Intergenic
986388566 5:7263960-7263982 CAATAAAGCTTTTAATCACCTGG - Intergenic
986389374 5:7269263-7269285 CAATAAAGCTTTTAATCACCTGG - Intergenic
987212940 5:15702784-15702806 CAATAAAGCTTTTAATCACCTGG + Intronic
988008089 5:25445869-25445891 CAATAAAGCTTTTAATCACCTGG + Intergenic
989573459 5:42967243-42967265 AAAAAAAGTTTTTAATTACCTGG + Intergenic
989768288 5:45112484-45112506 CAATAAAGCTTTTAATCACCTGG + Intergenic
990255295 5:53962218-53962240 CCATAATACTTTTAATCAACAGG + Intronic
990577279 5:57135583-57135605 CAAAAAGGCTTTTATTTACCAGG - Intergenic
991468112 5:66936407-66936429 CAATAAAGCTTTTAATCACCTGG + Intronic
992515789 5:77491381-77491403 AATAAAAGCTTTTAATCACCTGG - Intronic
992787693 5:80185551-80185573 AATAAAAGCTTTTAATCACCTGG + Intronic
994209948 5:97076178-97076200 TAATAAAGCTGAGAATCACCTGG - Intergenic
994239030 5:97398999-97399021 CAATAAAGCTTTTAATCACCTGG + Intergenic
994604827 5:101954127-101954149 CAATAAAGGTTTTTGTCCCCTGG + Intergenic
995296571 5:110531263-110531285 CAATAAAGCTTTTAATCACCTGG - Intronic
995297132 5:110535445-110535467 CAATAAAGCTTTTAATCACCTGG - Intronic
995883413 5:116867480-116867502 CAATAAAGCTTTTAATCACCTGG + Intergenic
995890487 5:116945674-116945696 CAATAAAGCTTTTAATCACCTGG + Intergenic
996510380 5:124309408-124309430 CAATAAAGCTTTTAATCACGTGG - Intergenic
996527747 5:124497375-124497397 CAATAAAGCTTTTAATCACCTGG - Intergenic
996528523 5:124502671-124502693 CAATAAAGCTTTTAATCACCTGG - Intergenic
997000906 5:129760868-129760890 CAATAAACCTTTTACCCTCCTGG - Intronic
999879929 5:155851050-155851072 TAGTAAAGCTTTTAATCAACTGG - Intergenic
999950962 5:156649919-156649941 GAACAAAGCTTTTCATTACCTGG + Intronic
1000127998 5:158266218-158266240 AAGTAAAGCTGTTAATTACCTGG + Intergenic
1000439100 5:161246132-161246154 CAATAAAGCTTTAAATCACCTGG - Intergenic
1000587020 5:163112808-163112830 CAGTAAAGGTTTTAGTCAACAGG + Intergenic
1000841639 5:166226845-166226867 CACCAAAGTTTATAATCACCAGG + Intergenic
1000898254 5:166882374-166882396 CAAACAAGCTTTTAATTAGCAGG + Intergenic
1003429679 6:6027856-6027878 CAATAAAGCTTTTAATCACCTGG + Intergenic
1003430509 6:6033233-6033255 CAATAAAGCTTTTAATCACCTGG + Intergenic
1004283019 6:14296988-14297010 CAATAAAGCTTTTAATCACCTGG + Intergenic
1004283873 6:14302424-14302446 CAATAAAGCTTTTAATCACCTGG + Intergenic
1005785840 6:29245525-29245547 CAATAAAGCTTTTAATCACCTGG + Intergenic
1006228283 6:32559071-32559093 CCATGAGGCTTTTAAACACCTGG - Intronic
1009343304 6:62586312-62586334 CAACAAAGCTTTTAATCACCTGG - Intergenic
1009344069 6:62591656-62591678 CAATAAAGCTTTTAATCACCTGG - Intergenic
1009359840 6:62797382-62797404 CAATACACTTTTTAATCACCTGG - Intergenic
1009648010 6:66433354-66433376 CAATCATGCATTTAATCACAAGG - Intergenic
1010498268 6:76562628-76562650 CAATAAAGCTTTTAATCACCTGG - Intergenic
1011487881 6:87861908-87861930 CAATAAAGCTTTTAATCACCAGG + Intergenic
1011582025 6:88879058-88879080 CAAGCAAGCTATTAACCACCTGG + Intronic
1011860299 6:91746899-91746921 TCATAAAGCTTTTAGTGACCAGG + Intergenic
1012031820 6:94079378-94079400 CAGTAAAGCTTTTAGCCATCTGG - Intergenic
1012815149 6:104014595-104014617 CAATATAGCTGTTAGTCATCTGG + Intergenic
1015212317 6:130712224-130712246 CAATAAAGCTTTTAATCACCTGG - Intergenic
1015324320 6:131907349-131907371 CAATAAAGCTTTTAATCACCTGG - Intergenic
1015800752 6:137060333-137060355 CAATAAAGCTTTTAATCACCTGG + Intergenic
1015801712 6:137066759-137066781 CAATAAAGCTTTTAATCACCTGG + Intergenic
1015931657 6:138366817-138366839 CAAAAAGCTTTTTAATCACCTGG + Intergenic
1016204225 6:141453156-141453178 CAATAAAGCTTTTAATCACCTGG - Intergenic
1016205320 6:141460612-141460634 CAATAAAGCTTTTAATCACCTGG - Intergenic
1016233122 6:141830329-141830351 CAATAAAGCTTTTAATTACCTGG - Intergenic
1016535270 6:145103232-145103254 CAACAAAGCTTTTAATTACCTGG + Intergenic
1016536061 6:145108505-145108527 CAATAAAGCTTTTAATCACCTGG + Intergenic
1016852948 6:148640111-148640133 CAATAAAGCTTTTAATCACCTGG - Intergenic
1016853755 6:148645440-148645462 CAATAAAGCTTTTAATCACCTGG - Intergenic
1017947902 6:159110612-159110634 CATTAACTCTTTAAATCACCAGG - Intergenic
1017979429 6:159386664-159386686 CACTAAATCTTTTAATAAACTGG + Intergenic
1018494909 6:164338815-164338837 CAATAAAGCTTTTAATCACCTGG + Intergenic
1018495789 6:164344417-164344439 CAATAAAGCTTTTAATCACCTGG + Intergenic
1019106787 6:169674786-169674808 CAATAAAGCTTTTAATCACCTGG + Intronic
1020250153 7:6461078-6461100 CAATAAAAATATTAATTACCTGG + Exonic
1020490924 7:8783025-8783047 CAATAAAGCTTTTAATCACCTGG - Intergenic
1020540538 7:9457748-9457770 CAATAAAGCTTTTAATCACCTGG + Intergenic
1020541426 7:9463815-9463837 CAATAAAGCTTTTAATCACCTGG + Intergenic
1021928111 7:25552750-25552772 CAATAAAGCTTTTAATGGAAAGG - Intergenic
1022677691 7:32514865-32514887 CAATAAAGCTTTTAATCACCTGG - Intronic
1022709591 7:32838203-32838225 CAATAAAGCTTTTAATCACCTGG - Intergenic
1023698387 7:42870622-42870644 CAATAAAGCTTTTAATCACCTGG + Intergenic
1023699210 7:42875970-42875992 CAATAAAGCTTTTAATCACCTGG + Intergenic
1023884755 7:44346052-44346074 CAATCAATCTTTTTATCCCCTGG + Intergenic
1024415574 7:49101425-49101447 CAATAAAGCTTTTAATCACCTGG - Intergenic
1029500755 7:100927964-100927986 CAATAACGCTTTTAATCACCTGG - Intergenic
1030823905 7:114130868-114130890 AAATAAAGCTTATAATGATCTGG - Intronic
1031283690 7:119838727-119838749 CAATAAAGTTTTTAATCACCTGG + Intergenic
1031364294 7:120885746-120885768 CAATAAAGCTTTTAATCACCTGG + Intergenic
1031365060 7:120891030-120891052 CAATAAAGCTTTTAATCACCTGG + Intergenic
1031421926 7:121563696-121563718 AATAAAAGCTTTTAATCACCTGG + Intergenic
1031727527 7:125259258-125259280 CGATAAAGCTTTTAATCACCTGG - Intergenic
1031776009 7:125910345-125910367 CAATAAAGCTTTTAATCACCTGG - Intergenic
1031776806 7:125915671-125915693 CAATAAAGCTTTTAATCACCTGG - Intergenic
1031777008 7:125917897-125917919 CAATAAGGCTTTCAATCACCTGG - Intergenic
1031777939 7:125924042-125924064 CAATAAAGCTTTTAATCACCTGG - Intergenic
1032372785 7:131376183-131376205 CAATAAAACATGTAAACACCAGG - Intronic
1032424207 7:131807568-131807590 CAACCAAGCATTTAAACACCTGG - Intergenic
1033909811 7:146248862-146248884 AATAAAAGCTTTTAATCACCTGG + Intronic
1036090356 8:5658249-5658271 CAACAAAGCTTTTTAGCCCCAGG - Intergenic
1036486652 8:9185410-9185432 AATGAAAGCTTTTAATCACTTGG - Intergenic
1037080820 8:14783737-14783759 TAATAAAGCTTTTAGTCATTTGG + Intronic
1037455842 8:19063194-19063216 CAATCAATCTTTTATTAACCTGG + Intronic
1037663801 8:20950172-20950194 CCTTGAAGCATTTAATCACCTGG + Intergenic
1038721055 8:30035598-30035620 AAATAAAGCTTTTAATCACCTGG - Intergenic
1039180400 8:34860233-34860255 CAATAAAGCTTTTAATCACCTGG + Intergenic
1039738885 8:40361466-40361488 CAATAATTTTTTTAACCACCTGG + Intergenic
1039973705 8:42342147-42342169 CAATAAAGTTTTTGGTGACCTGG - Intronic
1040062603 8:43116849-43116871 CAATAAAGCATTTAATCACCTGG + Intronic
1041247079 8:55898584-55898606 CAATAAAACTATTATTCAGCTGG - Intronic
1041303834 8:56439367-56439389 CAATAAAGCTTTTAATCATCTGG - Intronic
1041983260 8:63888541-63888563 AAATAAAGCTTTTAATCACCTGG - Intergenic
1042345212 8:67720013-67720035 CAATAAAGCTTTTAATCACCTGG + Intronic
1043539085 8:81239198-81239220 CAATTGAGCTTTGAATCACAGGG + Intergenic
1044161634 8:88924631-88924653 CAATAAACCTTTTAATCCTATGG + Intergenic
1044229211 8:89756207-89756229 CAATAAAGCTTTTAATCATGTGG - Intergenic
1045991132 8:108309803-108309825 CAATAAAGCTTTTAATCACCTGG + Intronic
1046440506 8:114247015-114247037 CAATAAAGCTTTTAATCACCTGG - Intergenic
1048097289 8:131310496-131310518 CAATAAAGTTTTTAATCACCTGG - Intergenic
1048135167 8:131741083-131741105 TAATAAAGCTTTTAATCAACTGG - Intergenic
1048135967 8:131746554-131746576 CAATAAAGCTTTTAATCACTTGG - Intergenic
1048144298 8:131825037-131825059 CAATAAAGCTTTTAATCACCTGG - Intergenic
1048164772 8:132052896-132052918 CTATAAAGCTTTTTCTCACCCGG + Intronic
1048668126 8:136687253-136687275 CAATAAAGCTTTTAATCACCTGG - Intergenic
1048814541 8:138319808-138319830 AATTAAAGCTGTTAATCAGCTGG + Intronic
1049897449 9:121643-121665 CCATAAAGCATTTAATGAACTGG - Intronic
1050117303 9:2276037-2276059 CAATGAAGCTTTTAATCACCTGG - Intergenic
1050118151 9:2281456-2281478 CAAAAAAGCTTTTAGTCACCTGG - Intergenic
1050251558 9:3750024-3750046 CAATAAAGCTTTTAATCACCTGG - Intergenic
1051605354 9:18912834-18912856 CAAAAAAATTTTTAATTACCTGG + Intergenic
1051986217 9:23090736-23090758 AAATGAAGCAGTTAATCACCAGG + Intergenic
1052472409 9:28916550-28916572 TAGAAAATCTTTTAATCACCTGG + Intergenic
1052654185 9:31334629-31334651 CAATAAAGCTTTTAATCACCTGG - Intergenic
1052720131 9:32164408-32164430 CAATAAAGCTTTTAATCACCTGG + Intergenic
1053740543 9:41131910-41131932 CCATAAAGCATTTAATGAACTGG - Intronic
1054443534 9:65288085-65288107 CCATAAAGCATTTAATGAACTGG - Intergenic
1054486740 9:65733418-65733440 CCATAAAGCATTTAATGAACTGG + Intronic
1054687806 9:68299389-68299411 CCATAAAGCATTTAATGAACTGG + Intronic
1055712451 9:79078095-79078117 CAATAACGTTTTCAAGCACCTGG - Intergenic
1055809721 9:80137673-80137695 CAATAAAGCTTTTAATCACCTGG - Intergenic
1056253688 9:84776520-84776542 TAATAAAGCTTTTAAGAAACAGG - Intronic
1056323500 9:85458705-85458727 CAATAAAGCTTTTAATCACCTGG - Intergenic
1056324748 9:85466876-85466898 CAATAAAGCTTTTAATCACCTGG - Intergenic
1057108636 9:92445586-92445608 CAATAAAGCTGTTATTGGCCGGG + Intronic
1060737348 9:126074496-126074518 CAATAAAGCTTTTAATCACCTGG + Intergenic
1060738216 9:126080064-126080086 CAATAAAGATATTAATCACCTGG + Intergenic
1061011741 9:127960027-127960049 CAATAAAGCTGTTAAATACATGG + Intronic
1203425599 Un_GL000195v1:33731-33753 AATAAAAGCTTTTAATCACCTGG - Intergenic
1185751966 X:2618631-2618653 CAATAAAGTATTTAGTCACGTGG + Intergenic
1186112363 X:6272266-6272288 CAATAAAGCTTTTAATCACCTGG + Intergenic
1186113212 X:6277581-6277603 CAATAAAGCTTTTAATCACCTGG + Intergenic
1186645149 X:11499003-11499025 CAATACAGATTTTAAGAACCAGG + Intronic
1186721567 X:12310073-12310095 CAATAAAGCTTTTAATCACCTGG + Intronic
1187086847 X:16050062-16050084 TAATAAAGCTTTTAATCACCTGG + Intergenic
1187099493 X:16179248-16179270 CAATAAAGCTTTTAATCACCTGG + Intergenic
1187100206 X:16184075-16184097 CAATAAAGCTTTTAATCACCTGG + Intergenic
1188950550 X:36368038-36368060 CTATAAAGCCTTGCATCACCTGG - Intronic
1190447028 X:50536209-50536231 CTATAAAGCTCTTCATGACCTGG - Intergenic
1191161840 X:57338111-57338133 AATAAAAGCTTTTAATCACCTGG + Intronic
1191762187 X:64657597-64657619 CAATAAAGCTTTTAATCACCTGG - Intergenic
1194060598 X:89191901-89191923 CAATAAAGCTTTTAATCACCTGG - Intergenic
1194660371 X:96624359-96624381 CAATAAAGCTTTTAATCACCTGG - Intergenic
1194661275 X:96630380-96630402 CAATAAAGCTTTTAATCACCTGG - Intergenic
1194873210 X:99158768-99158790 CAATAAAGCTTTTAATCACCTGG + Intergenic
1194874128 X:99164833-99164855 CAATAAAGCTTTTCATCACCTGG + Intergenic
1195052180 X:101107298-101107320 CAAAAAAGCTTTCAATCACAGGG - Intronic
1195841153 X:109178724-109178746 CAATAAAGCTTTTAATCACCTGG - Intergenic
1195841990 X:109184090-109184112 AAATAAAGCTTTTAATCACCTGG - Intergenic
1196533055 X:116812494-116812516 CAATAAAGCTTTTAATCACCTGG + Intergenic
1196533851 X:116817820-116817842 CAATAAAGCCTTTAATCACCTGG + Intergenic
1196920786 X:120583344-120583366 AAATAATGCTTTTGGTCACCTGG + Intergenic
1197251580 X:124221586-124221608 CAATAAAGCTTTTAAAAAATGGG - Intronic
1197291041 X:124658098-124658120 CTTTAAAGCATTTAATCACAGGG - Intronic
1197322421 X:125049067-125049089 CAATAAAGCTGTTAAAAAACAGG - Intergenic
1197532184 X:127642998-127643020 CAATAAGGCTTTATATGACCTGG - Intergenic
1198598114 X:138258991-138259013 CAATAAAGCTTTTAATCACCTGG - Intergenic
1200823274 Y:7610846-7610868 TAATAAAGCCTATAATGACCAGG + Intergenic
1201607164 Y:15799770-15799792 CAATAAAGCTTTTAATCACCTGG + Intergenic
1201725048 Y:17141771-17141793 CAATAAAGCTTTTAATCACCTGG + Intergenic
1201725147 Y:17142556-17142578 CAATAAAGCTTTTAACTACCTGG + Intergenic
1201786716 Y:17791318-17791340 CAATAACACTTTGAATCTCCTGG + Intergenic
1201814837 Y:18114670-18114692 CAATAACACTTTGAATCTCCTGG - Intergenic
1201865238 Y:18645423-18645445 CAATAAAGCTTTTAATCGCCTGG - Intergenic
1201936116 Y:19412396-19412418 CAATAAAGCTTTTAATCACCTGG - Intergenic
1201937969 Y:19427670-19427692 CAATAAAGCTTTTAATCACCTGG - Intergenic
1202061816 Y:20896845-20896867 AAAAAAACTTTTTAATCACCTGG - Intergenic
1202076862 Y:21044793-21044815 CAATAAAGCTTTTAACCACCTGG + Intergenic
1202236781 Y:22720249-22720271 TAATAAAGCCTATAATGACCAGG - Intergenic
1202306386 Y:23475919-23475941 TAATAAAGCCTATAATGACCAGG + Intergenic
1202330239 Y:23743313-23743335 CAATAAAACTTTGAATCTCCTGG + Intergenic
1202540531 Y:25926749-25926771 CAATAAAACTTTGAATCTCCTGG - Intergenic
1202564423 Y:26194670-26194692 TAATAAAGCCTATAATGACCAGG - Intergenic