ID: 1060737349

View in Genome Browser
Species Human (GRCh38)
Location 9:126074497-126074519
Sequence AATAAAGCTTTTAATCACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 697
Summary {0: 240, 1: 75, 2: 45, 3: 26, 4: 311}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060737343_1060737349 30 Left 1060737343 9:126074444-126074466 CCACTTTCATGTGCGTCCGTGTG No data
Right 1060737349 9:126074497-126074519 AATAAAGCTTTTAATCACCTGGG 0: 240
1: 75
2: 45
3: 26
4: 311
1060737344_1060737349 14 Left 1060737344 9:126074460-126074482 CCGTGTGAAGAGACCACCAAACA 0: 1480
1: 638
2: 165
3: 77
4: 177
Right 1060737349 9:126074497-126074519 AATAAAGCTTTTAATCACCTGGG 0: 240
1: 75
2: 45
3: 26
4: 311
1060737346_1060737349 1 Left 1060737346 9:126074473-126074495 CCACCAAACAGGCTTTGTGTGAG 0: 1811
1: 754
2: 177
3: 58
4: 177
Right 1060737349 9:126074497-126074519 AATAAAGCTTTTAATCACCTGGG 0: 240
1: 75
2: 45
3: 26
4: 311
1060737347_1060737349 -2 Left 1060737347 9:126074476-126074498 CCAAACAGGCTTTGTGTGAGCAA 0: 1836
1: 751
2: 164
3: 55
4: 160
Right 1060737349 9:126074497-126074519 AATAAAGCTTTTAATCACCTGGG 0: 240
1: 75
2: 45
3: 26
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060737349 Original CRISPR AATAAAGCTTTTAATCACCT GGG Intergenic
900841630 1:5053029-5053051 AATAAAGCTTTTAATCACCTGGG - Intergenic
901111879 1:6803873-6803895 AAAAAAAATTTTAATCAGCTAGG - Intronic
901598918 1:10407287-10407309 AAAAAAGTTTTTAATTAGCTGGG + Intronic
905060834 1:35137661-35137683 AATAAAGCTTTTAATCACCTGGG + Intergenic
905612321 1:39364884-39364906 AATAAATTTTTTCATAACCTGGG - Intronic
907295504 1:53449754-53449776 ATAAAAGCTTTTAATCACCTGGG - Intergenic
908184140 1:61635515-61635537 AAAAAAGATTATAATCAACTAGG + Intergenic
909035157 1:70588724-70588746 AATAAAGCTTTTAATCATCTGGG - Intergenic
909035950 1:70593919-70593941 AATAAAGCTTTTAATCACCTGGG - Intergenic
909223165 1:72987848-72987870 AATAAAGCTTTTAATCACCTGGG + Intergenic
909467279 1:75986440-75986462 ATTTAGGTTTTTAATCACCTGGG + Intergenic
909787789 1:79638809-79638831 AATAAAGCTTTTAATCATCTGGG + Intergenic
909788578 1:79644130-79644152 AATAAAGCTTTTAATCACCTGGG + Intergenic
910035769 1:82785872-82785894 AATAAAGCTTTTAATGCTATAGG - Intergenic
910667672 1:89742159-89742181 AAAAAAGCTTTTATTCCTCTGGG + Intronic
911228170 1:95331221-95331243 AATAAAGCATTTTATTACATGGG + Intergenic
911510101 1:98801102-98801124 CATAAAGCTTTTAATCTCCTGGG + Intergenic
911510892 1:98806462-98806484 AATAAAGCTTTTAATCTCCTGGG + Intergenic
911905065 1:103556740-103556762 GATAATGCTTTCAATCTCCTAGG - Intronic
912162082 1:106997540-106997562 ATTAAATCTATAAATCACCTTGG - Intergenic
912240182 1:107898568-107898590 AATAAAGCTTTCAATCTCTAGGG + Intronic
914217527 1:145646146-145646168 CATCAAGGTTTTAATCACATAGG - Intronic
914455696 1:147834223-147834245 AATAAAGCTTTTAATCACCTGGG - Intergenic
914470094 1:147968837-147968859 CATCAAGGTTTTAATCACATAGG - Intronic
915669374 1:157475699-157475721 AAAAAATCTTTTAATAACCAAGG + Intergenic
915827057 1:159089175-159089197 AATAATGCTTATAAGCACCTAGG - Intronic
915976853 1:160396946-160396968 ACTGCAGATTTTAATCACCTGGG - Intergenic
916297264 1:163233571-163233593 AATAAAGCTTTTAATCACCTGGG + Intronic
916512509 1:165484845-165484867 ACTAAAACTTTTAATCACCCTGG - Intergenic
916802508 1:168227717-168227739 AATAAAGCTTTAAATAACGAGGG - Intronic
917288624 1:173448464-173448486 AATAAAGCTTTTAACCACCTGGG + Intergenic
918508905 1:185288747-185288769 AATAACTCTTTTAATCTACTGGG - Intronic
918603201 1:186388735-186388757 TCTCAAGCTTTTTATCACCTTGG - Intronic
918973876 1:191455005-191455027 AGTATAGCTTATAAACACCTAGG - Intergenic
919196226 1:194290021-194290043 AATGAGGTTTTTAATCCCCTAGG + Intergenic
919476944 1:198040922-198040944 AATAAAGCTTTTAATCACCTGGG - Intergenic
919544789 1:198902161-198902183 AATTAATATTTTAAACACCTTGG + Intergenic
920026864 1:203005489-203005511 AATAAAGCTCTTAATCACCTGGG + Intergenic
920228905 1:204457474-204457496 AATAAAGCCTTTACTGGCCTGGG + Intronic
921649826 1:217664273-217664295 AAAAAAGATTTTTAACACCTAGG - Intronic
923826286 1:237504216-237504238 AATAAAGCTTTTAATCACCTGGG + Intronic
923829684 1:237541624-237541646 ATTAAAGCTTTTAATCACCTGGG + Intronic
923962449 1:239101555-239101577 AATAAAGCTTTTAATCACCTAGG - Intergenic
923963278 1:239106993-239107015 AATAAAGCTTTTAATCACCTGGG - Intergenic
924086667 1:240459055-240459077 TTTAAAGCTTCTAATCACATTGG - Intronic
924180311 1:241434220-241434242 AATAAAGCTTTTAATCACCTGGG - Intergenic
924181182 1:241439813-241439835 AGTAAACCTTTTAATCACCTGGG - Intergenic
924183247 1:241460557-241460579 AATAAAGCTATTACTCCCCTTGG + Intergenic
924478401 1:244402964-244402986 AATGAAACTTTTAATGACCTTGG + Intergenic
924895641 1:248335813-248335835 AATAAAGCTTTTAATCACCTGGG + Intergenic
924896334 1:248340745-248340767 AACAAAGCTTTTAATCACCTGGG + Intergenic
1065046492 10:21751420-21751442 AATAAAGCTTTTAATCACCTGGG + Intergenic
1065455453 10:25902436-25902458 AATAAAGCTTTTAATCACCTGGG + Intergenic
1066805553 10:39248267-39248289 AAGAAAGCTTTAAATCTGCTAGG - Intergenic
1067409821 10:46054604-46054626 AATAAAACTTTTAATTCACTTGG + Intergenic
1068168223 10:53358860-53358882 AATAAAGCTTTTAATCACCTGGG + Intergenic
1068522601 10:58094131-58094153 ATAAAACTTTTTAATCACCTGGG + Intergenic
1068803895 10:61173158-61173180 AATAAAGCAGTTAATCTCATTGG + Intergenic
1068826174 10:61442102-61442124 AGTAAAGCTTTTAAAAAGCTTGG - Intronic
1069401707 10:68054668-68054690 GATAAAGATATTAATCACTTGGG + Intronic
1069562473 10:69440539-69440561 AAAAAAGCTTTTAATCTTTTTGG - Intergenic
1071217942 10:83429561-83429583 AATAAAGCTTTTACTCACCTGGG + Intergenic
1071500947 10:86204067-86204089 AACACAGCTTTTGATCACATTGG + Intronic
1071590224 10:86865530-86865552 ATAAAAGCTTTTAATCACCTGGG - Intronic
1071752700 10:88499118-88499140 CATAACACTTTTAATCACTTCGG - Intronic
1071924055 10:90384892-90384914 AATAAAGCTTTTAATCACCTGGG - Intergenic
1071960774 10:90807668-90807690 AATACAGCTTTTAATCACCTGGG - Intronic
1071961625 10:90813189-90813211 AATACAGCTTTTAATCACCTGGG - Intronic
1072010793 10:91301397-91301419 AATAAAGCTTTTAATCAGCTGGG + Intergenic
1073132778 10:101201050-101201072 AATAAAACTTTTAATCACCTGGG + Intergenic
1073295496 10:102436005-102436027 AATAAAGATTTGAAGTACCTGGG - Intergenic
1073366106 10:102942842-102942864 TATAAAGTTTTTAATAACATGGG + Intronic
1074174751 10:110986935-110986957 AGCAAAACTTTTAATCACTTGGG - Intronic
1074740454 10:116481014-116481036 AATAAAGCTTTTAATCACCTGGG - Intergenic
1074741280 10:116486449-116486471 AATAAAGCTTTTAATCACCTGGG - Intergenic
1076516802 10:131050231-131050253 ATAAAACTTTTTAATCACCTGGG - Intergenic
1077611860 11:3648237-3648259 AATAAAGCTTTTAATCACCTGGG - Intronic
1077765900 11:5160344-5160366 AATAAAGCTTTTTATCACCTGGG + Intronic
1078520975 11:12062640-12062662 AAAAAATCTTTTTATTACCTGGG + Intergenic
1079018545 11:16889374-16889396 AATAAAGCTTTTAATTCACCTGG - Intronic
1079265816 11:18931869-18931891 AATAAAGTTTGTCCTCACCTGGG - Intergenic
1079370964 11:19851872-19851894 AAGAATGCTTGTAATCACATTGG - Intronic
1079727408 11:23892573-23892595 AATAAAGCTTTTAATCACCTGGG + Intergenic
1080027411 11:27629119-27629141 AATAAAGCTTTTAATCACCTGGG + Intergenic
1080028252 11:27634526-27634548 AATAAAGCTTTTAATCACCTGGG + Intergenic
1081829293 11:46093530-46093552 AATAACAATTTTAATCACCAAGG + Intronic
1083543208 11:63529366-63529388 AATAAAGCTTTTAATCACCTGGG + Intergenic
1084355047 11:68632727-68632749 AGTAAAGCTTTTAATCACCTGGG - Intergenic
1084355242 11:68634101-68634123 AATAAAGCTTTTAATCACCTGGG - Intergenic
1084356047 11:68639370-68639392 AATAAAGCTTTTAATCACCTGGG - Intergenic
1085236974 11:75022829-75022851 AATAAAGTTTTGATCCACCTGGG - Intergenic
1085748933 11:79142390-79142412 AATAAAGTTGTTAAATACCTAGG + Intronic
1085761132 11:79242598-79242620 TATAGAGCTTTTAATGACATGGG - Intronic
1085858068 11:80198336-80198358 ATAAAAGCTTTTAATCACCTGGG + Intergenic
1086552758 11:88071216-88071238 ATAAAAGCTTTTAATCCACTGGG + Intergenic
1087098791 11:94346054-94346076 AATAAAGCTTTTAATCACCTGGG - Intergenic
1087100146 11:94355465-94355487 AATAAGGCTTTTAATCACCTGGG - Intergenic
1087127491 11:94641940-94641962 AATAAAGCTTTTAATCACCTGGG - Intergenic
1087128298 11:94647242-94647264 AATAAAGCTTTTAATCACCTGGG - Intergenic
1087225893 11:95598285-95598307 AATAAAACTCTCAAACACCTAGG + Intergenic
1087839044 11:102904047-102904069 AATAAAGCTTTTAATCACCTGGG + Intergenic
1087839863 11:102909548-102909570 AATAAAGCTTTTAATCACCTGGG + Intergenic
1088388005 11:109281366-109281388 AATAGAGCTTTAAACCACCAAGG - Intergenic
1089470574 11:118717081-118717103 AATAAAGCTTTTAATCACTTGGG + Intergenic
1089472402 11:118731493-118731515 AATAAAGCTTCTAATCACCTGGG + Intergenic
1089952939 11:122546956-122546978 AATAAAGCTTTTAATCACCTGGG - Intergenic
1089954200 11:122555533-122555555 AATAAAGCGTTTAATCACCAGGG - Intergenic
1089987077 11:122824761-122824783 AATAAAGCTTTTAATCACCTGGG - Intergenic
1089988152 11:122832753-122832775 AATAAAGCTTTTAATCACCTGGG - Intergenic
1090025287 11:123162478-123162500 AATAAATCTTTCAGGCACCTGGG + Intronic
1090531328 11:127593785-127593807 AATAAAGCTTACAGTCACCGTGG - Intergenic
1091035670 11:132230861-132230883 AAAAAATTTTTTAATCAGCTGGG + Intronic
1091183335 11:133627116-133627138 AATAAAGCTTTTAATCACCTGGG - Intergenic
1091184188 11:133632623-133632645 AATAAAGCTTTTAATCACCTGGG - Intergenic
1091932284 12:4405580-4405602 AAGAAAGCTTTTAATGAGTTGGG - Intergenic
1092474155 12:8805212-8805234 AATAAAGCTTTTAATCACCTGGG - Intergenic
1092474962 12:8810507-8810529 AATAAAGCTTTTAATCACCTGGG - Intergenic
1092475222 12:8813264-8813286 AATAAAGCTTTTAATCACCTGGG - Intergenic
1092924301 12:13259686-13259708 AATAAAGCTTTTAATCACCTGGG + Intergenic
1092925126 12:13265167-13265189 AATAAAGCTTTTAATCACCTGGG + Intergenic
1093222144 12:16434565-16434587 AATGAATCTTTGAATCATCTAGG - Intronic
1093277028 12:17141752-17141774 TATAAAGCTTTTAGTCATGTTGG + Intergenic
1093321499 12:17720299-17720321 AATAAAGCTTTTAATCACCTGGG + Intergenic
1093358269 12:18196089-18196111 AATAAAGCTTTTAATCATCTGGG - Intronic
1093359337 12:18203658-18203680 AATAAAGCTTTTAATCACCTGGG - Intronic
1094315484 12:29134658-29134680 AATAAAGCTTTTAATCACCTGGG + Intergenic
1094329437 12:29275114-29275136 AATAAAGCTTTTAATCATCTGGG + Intronic
1095651244 12:44612379-44612401 AAGAAAGATTTCAATCACCAAGG + Intronic
1095794622 12:46204751-46204773 AATAAATCTTGTATTCACTTGGG - Intronic
1097368739 12:58749177-58749199 AATGGAGCTTTTATTCCCCTAGG + Intronic
1097541599 12:60951315-60951337 AATAAAGCTTTTAATCACCTGGG + Intergenic
1097542499 12:60957262-60957284 AATAAAGCTTTTAATCACCTGGG + Intergenic
1098206251 12:68113499-68113521 AATAAGGCATATAATAACCTTGG + Intergenic
1098252446 12:68584454-68584476 AATAAAGCTCTTAGTGACCTCGG - Intergenic
1098554473 12:71803144-71803166 AATAAAGCTTTTAGTCTAGTGGG + Intergenic
1098591152 12:72215054-72215076 AATAAAGTTTTTAATCACCTGGG + Intronic
1098841601 12:75484552-75484574 AATAAAGCTTTTTATCACCTGGG + Intronic
1098986634 12:77019161-77019183 AATACAGATATAAATCACCTAGG + Intergenic
1099106104 12:78498235-78498257 AATGAATCTTTTAATTACCTTGG + Intergenic
1099281299 12:80650795-80650817 AATAAAACTTTTTATCTACTTGG - Intronic
1099319741 12:81131193-81131215 AATAAATCTATAAATTACCTTGG + Intronic
1100906714 12:99308839-99308861 AATAAATCTATAAATTACCTAGG - Intronic
1100939983 12:99715520-99715542 AATAAAGCTTTTAATCACCTGGG - Intronic
1100940894 12:99721668-99721690 AATAAAGCTTTTAATCACCTGGG - Intronic
1101582691 12:106057219-106057241 AATAAATCTATAAATCATCTGGG - Intergenic
1101593418 12:106141929-106141951 AATAAAGCTTTTAATCACCTGGG + Intergenic
1102604173 12:114056102-114056124 AATAAAGTTTTTAATCACCTGGG - Intergenic
1102736755 12:115168675-115168697 ATTAATGCTTGCAATCACCTTGG + Intergenic
1103598635 12:122040003-122040025 AATAAAAATTTTAAAAACCTTGG + Intronic
1103743122 12:123104730-123104752 AATAAAGCTTTTAATCACCTGGG - Intronic
1105523363 13:21151957-21151979 AATAAACCTTTTAAACTGCTAGG + Intergenic
1105791985 13:23810467-23810489 AAGAAAGCCTTAAATCACATAGG - Intronic
1106042594 13:26107812-26107834 AATATATCTTTTATTTACCTGGG - Intergenic
1107015361 13:35704631-35704653 AAGACAGCTTTTACTCTCCTTGG + Intergenic
1108202360 13:48056695-48056717 AATAAAGCTTTTAATCACCTGGG - Intronic
1108203222 13:48062220-48062242 AATAAAGCTTTTAATCACCTGGG - Intronic
1108343921 13:49525574-49525596 AATAAAGGTTTTAAACTCATGGG - Intronic
1108912925 13:55578275-55578297 AATAAAGCTTTTAATCACCTGGG + Intergenic
1108913747 13:55583685-55583707 AATAAAGCTTTTAATCACCTGGG + Intergenic
1108952315 13:56110360-56110382 AATAAAGCATTTAATCACCTGGG - Intergenic
1109269846 13:60242787-60242809 AATAAATTTTTTAATCAATTTGG - Intergenic
1110649986 13:77933270-77933292 AATAAAGCTTTTAATCACCTGGG + Intergenic
1110650825 13:77939027-77939049 AATAAAGCTTTTAATCACCTGGG + Intergenic
1110765970 13:79279752-79279774 AATAAAGCTTTTAATCACCTGGG - Intergenic
1110845906 13:80189910-80189932 AATAAAGCTTTTAATCACCTGGG - Intergenic
1110978142 13:81866435-81866457 AATAAAGCTTTTAATCACCTGGG - Intergenic
1110979032 13:81872362-81872384 AATAAAACTTTTAATCACCTGGG - Intergenic
1111361616 13:87186496-87186518 AATAAAGCTTTTAATCACCTGGG + Intergenic
1111362423 13:87191747-87191769 AATAAAGCTTTTAATCACCTGGG + Intergenic
1111579440 13:90204032-90204054 AATAATGCATTTAAGCACATTGG + Intergenic
1111916116 13:94362403-94362425 AATAAAGCTTTGGTTAACCTTGG + Intronic
1112280869 13:98061901-98061923 ATAAAAGCTTTTAATCACCTGGG + Intergenic
1112888792 13:104207637-104207659 AATAAAGCTTTTAATCACCTGGG + Intergenic
1112889648 13:104213469-104213491 AATAAAGCTTTTAATCACCTGGG + Intergenic
1113014555 13:105813835-105813857 AATAAATCTCTTAATCATTTTGG + Intergenic
1115626338 14:35196501-35196523 AATAAATATTTTCATCACATGGG + Intronic
1115904463 14:38191014-38191036 AATAAAGCTTTTAATCACCTGGG - Intergenic
1115905310 14:38196458-38196480 AATAAAGCTGTTAATCACCTGGG - Intergenic
1116185797 14:41599717-41599739 ATAAAAGCTTTTAATCACCTGGG + Intergenic
1117437429 14:55730115-55730137 AATGAAGCGGTTGATCACCTTGG - Intergenic
1117801656 14:59449716-59449738 AATAAAGCTTTTAATCACCTGGG - Intronic
1119022082 14:71124545-71124567 AATAAAGCTTTTAATCACCTGGG - Intergenic
1119022892 14:71129937-71129959 AATAAAGCTTTTAATCACCTGGG - Intergenic
1119940313 14:78633726-78633748 AAACAGGGTTTTAATCACCTGGG + Intronic
1120305109 14:82760200-82760222 AATAAAGCTTTTAATCACCTGGG + Intergenic
1120437575 14:84500297-84500319 AATAAAGCTTTTAATCACCTGGG + Intergenic
1120438376 14:84505612-84505634 AATAAAGCTTTTAATCACCTGGG + Intergenic
1120458855 14:84767541-84767563 ATTAGAGCTTTAAAGCACCTCGG + Intergenic
1120532545 14:85649887-85649909 AACAAACTTTATAATCACCTAGG - Exonic
1120618001 14:86731927-86731949 AATAAAGCTTTTAATCACCTGGG - Intergenic
1120618724 14:86736991-86737013 AATAAAGCTTTTAATCACCTGGG - Intergenic
1120784501 14:88520016-88520038 TAAAAAGCTATTAATCTCCTAGG + Intronic
1121289111 14:92760134-92760156 AATAAAGCTTTTAATTCACCTGG - Intergenic
1121703337 14:95973361-95973383 AATAAACCTTTTAATCACCTGGG - Intergenic
1121704170 14:95978791-95978813 AATAAACCTTTTAATCACCTGGG - Intergenic
1122040690 14:98985615-98985637 AATAAAGCTTTTAATCACCTGGG - Intergenic
1122041783 14:98992870-98992892 AATAAAGCTTTTAATCACCTGGG - Intergenic
1123160156 14:106270461-106270483 AATAAAGCTTCTACTCAGCCTGG + Intergenic
1123207781 14:106730005-106730027 AATAAAGCTTCTACTCAGCTGGG + Intergenic
1123871877 15:24583834-24583856 AATAAAAGTTTTTATTACCTTGG - Intergenic
1124103966 15:26720267-26720289 ATAAAGGTTTTTAATCACCTGGG - Intronic
1124403017 15:29366821-29366843 AATACAGTTCTTAATCATCTTGG - Intronic
1124926095 15:34072106-34072128 AAAAAAGTTTTTAATTAGCTAGG + Intergenic
1126151090 15:45524058-45524080 AAAAAAGCTATCAATCATCTAGG + Intergenic
1126484199 15:49160972-49160994 AATAAACCTCTTAACTACCTCGG - Intronic
1127185425 15:56474716-56474738 AATACACCTTTAATTCACCTGGG + Intergenic
1128021831 15:64398445-64398467 AAAAAAGTTTTTAATTAGCTGGG + Intronic
1128201648 15:65813927-65813949 AATAAATGTTTTAATTAGCTAGG + Intronic
1131685241 15:94760307-94760329 AAGAAAGCTTTTAATCACCTGGG - Intergenic
1131975233 15:97938735-97938757 AATAAAGTTTGTATTCACATTGG - Intergenic
1132257992 15:100394499-100394521 AATACAGGTTTGAATCACATGGG + Intergenic
1133651080 16:7815025-7815047 AATAAAGCTTTTAATCACCTGGG - Intergenic
1133651878 16:7820328-7820350 AATAAAGCTTTTAATCACCTGGG - Intergenic
1133854331 16:9535456-9535478 AATAAACATTTGAAACACCTAGG + Intergenic
1133868989 16:9670577-9670599 AATAAAGCTTTTAATCACCTGGG + Intronic
1133869931 16:9676869-9676891 AATAAAGCTTTTAATCACCTGGG + Intergenic
1135345192 16:21683199-21683221 AATTAAGCCATTATTCACCTTGG + Intronic
1135829054 16:25757303-25757325 AATAAAACTTTTAAAAACCTTGG + Intronic
1137068433 16:35875582-35875604 AATAAACCTATAAATCACATCGG + Intergenic
1137302661 16:47167676-47167698 AATAAAGCTTTTAATCACCTGGG - Intronic
1137436458 16:48458081-48458103 AATAAACCCTTTAACCAGCTAGG - Intergenic
1137949581 16:52770951-52770973 AATAAAGCTACTCAGCACCTTGG + Intergenic
1138756168 16:59488249-59488271 AATAAATATTATAATCACCTAGG - Intergenic
1138758221 16:59514958-59514980 AATAAAGCTTTTAATCACCTGGG + Intergenic
1138759350 16:59522576-59522598 AATAAAGCTTTTAATCACCTGGG + Intergenic
1140716305 16:77728546-77728568 CGTAAATCTCTTAATCACCTCGG + Intronic
1141070561 16:80950714-80950736 AATAAAGCTACTGACCACCTCGG + Intergenic
1144193276 17:12866229-12866251 AATTGAGATTTTAATCTCCTGGG + Intronic
1144409932 17:14991125-14991147 AATAAGGATATTAATCAGCTCGG + Intergenic
1145024583 17:19458381-19458403 AATAAAGCTTTTAATCACCTGGG + Intergenic
1145926477 17:28650937-28650959 CAAAAAACTTTTAATTACCTGGG - Intronic
1146730422 17:35188632-35188654 AAAAAATTTTTTAATTACCTGGG - Exonic
1146782953 17:35692510-35692532 AATATAGGTTTTTATCAGCTGGG - Intronic
1146905740 17:36616878-36616900 AAAAACGTTTTTAATCAGCTGGG - Intergenic
1148393650 17:47291423-47291445 AAGAAAGGTATTAATTACCTTGG - Intronic
1149647867 17:58253487-58253509 TTTAAAGCTTTTTATAACCTGGG + Intronic
1149890536 17:60385332-60385354 ATGAAGGTTTTTAATCACCTGGG - Intronic
1150978650 17:70118178-70118200 AAAACAGGTTTAAATCACCTAGG - Intronic
1153609939 18:6873900-6873922 AATAAAGCTGAAAATCACCAGGG - Intronic
1155129533 18:22918138-22918160 TTTAAGGCTTTTAATCATCTTGG - Intronic
1155574801 18:27232636-27232658 AATAAAGCTTTTAATCACCTGGG - Intergenic
1155720022 18:29000397-29000419 AATAAAGCTTTTAATCACCTGGG + Intergenic
1156417346 18:36910689-36910711 ATTAAATCTGTAAATCACCTTGG + Intronic
1156428967 18:37049733-37049755 AATAAGGCTGTGATTCACCTTGG + Intronic
1156923544 18:42552488-42552510 AATAAACCTTTTAATCACCTGGG + Intergenic
1156924341 18:42557740-42557762 AATAAAGCTTTTAATCACCTGGG + Intergenic
1156939204 18:42744231-42744253 AATAAAGCTTTTAATCACCTGGG - Intronic
1156958706 18:42996740-42996762 AATAAAGCTTTTAATCACCTGGG - Intronic
1157453225 18:47803438-47803460 AAGACAGCTTTCACTCACCTTGG + Intergenic
1157905908 18:51570110-51570132 AATAAATCTTTTAATCACCTGGG + Intergenic
1158336028 18:56415814-56415836 AATAAAGCTTTTAATCACCTGGG - Intergenic
1158336857 18:56421272-56421294 AATAAAGCTTTTAATCACCTGGG - Intergenic
1159484320 18:69034876-69034898 AATATAGCTTTTTATCATTTCGG + Intronic
1159678543 18:71317591-71317613 AATAAAGCTCTCAACAACCTCGG + Intergenic
1162266804 19:9582573-9582595 AATAAAGCTTTTAATCACCTGGG - Intronic
1162895331 19:13762032-13762054 AATAAATGTTTTAATTAGCTGGG + Intronic
1163487000 19:17593854-17593876 AATAAAGCTTTTAATCACCTGGG - Intergenic
1163896030 19:20059988-20060010 ATAACAGCTTTTAATCACCTGGG - Intergenic
1163897101 19:20068856-20068878 ATAAAAGCTTTTAATCACCTGGG + Intergenic
1163899291 19:20087734-20087756 AATAAAGCTTTTGATCACCTGGG + Intronic
1164070333 19:21762350-21762372 AAGAAAGCTTTTCATGAACTGGG - Intronic
1165241298 19:34470501-34470523 AATAAAGCTTTTAATGGCAGTGG + Exonic
1166013163 19:39959008-39959030 ATAAAAGCTTTTAATCACCTGGG - Intergenic
1166401341 19:42482771-42482793 AAAAAAGTTTTTAATTAGCTGGG - Intergenic
1167084068 19:47297088-47297110 AATAAAGCTTTTAATCACCTGGG - Intronic
1167407401 19:49321759-49321781 AACAAAATTTTTAATTACCTGGG + Intronic
1167901841 19:52628123-52628145 AATAAAACTTTATTTCACCTGGG - Intronic
1168131289 19:54321294-54321316 AGTAAAGCTTTTAATCACCTGGG + Intergenic
1168135421 19:54347998-54348020 AATAAAGCTTTTAATTCACCTGG + Intergenic
1168227501 19:55006876-55006898 AATAAAGCTTTTAATCACCTGGG + Intergenic
1168228288 19:55012063-55012085 AATAAAGCTTTTAATCACCTGGG + Intergenic
927424791 2:22970241-22970263 ATAAAAGCTTTTAATCACCTGGG + Intergenic
928779220 2:34801046-34801068 AATAAAGCTTTATTTCACCTGGG + Intergenic
929076186 2:38080849-38080871 AATAAAGCTTTTAATCACCTGGG + Intronic
929077012 2:38086162-38086184 AATAAAGCTTTTAATCACCTGGG + Intronic
929728512 2:44459440-44459462 AATAATACATTTCATCACCTAGG - Intronic
929963223 2:46512123-46512145 AATAAAGGTTTCAAATACCTTGG - Exonic
930113416 2:47698328-47698350 AATAATGCTTTTAATTACCTGGG + Intronic
930233664 2:48868302-48868324 CATAAAGCTGTTTATCAGCTGGG + Intergenic
930349890 2:50237630-50237652 TATAAGGCTTGTATTCACCTTGG - Intronic
930479540 2:51928771-51928793 AATAATGCATATAATTACCTTGG - Intergenic
930487618 2:52027238-52027260 AATAAAGCTTTTAATCACCTGGG + Intergenic
930521812 2:52477157-52477179 AATGCAGCTTCTAATCACTTTGG + Intergenic
930952406 2:57158442-57158464 AATCCAGTTTTTAATCAGCTGGG - Intergenic
931608406 2:64074856-64074878 AATAAAGCTTTTAATTACCTGGG + Intergenic
931625441 2:64252826-64252848 AATAAAGCTTTTAATCTCCTGGG - Intergenic
931626185 2:64257577-64257599 AATAAAGCTTTTAATCACCTGGG - Intergenic
931947930 2:67331845-67331867 AATAAAGCTTTTAATCACCTGGG - Intergenic
931948763 2:67337532-67337554 AATAAAGCTTTTAATCACCTGGG - Intergenic
932296342 2:70626340-70626362 AATAAAGCTTTTAATCACCTGGG - Intronic
932843286 2:75105561-75105583 GATAAATATTTTAATCAGCTTGG + Intronic
932968479 2:76507610-76507632 AATGAAGCTTTTATTCAATTAGG + Intergenic
933246112 2:79976531-79976553 AATAGAACTTTTAATCCACTGGG - Intronic
934904979 2:98192274-98192296 AATAAAGCTTTTAATCACCTGGG + Intronic
936175671 2:110218261-110218283 AATAAAGCTTTTAATCACCTAGG - Intergenic
936764191 2:115825680-115825702 AATAATACATTCAATCACCTTGG - Intronic
936856273 2:116961371-116961393 AATAAACATTTTATTCACCCTGG - Intergenic
936946870 2:117939040-117939062 AATAAACCTTTTTATCATCCAGG + Exonic
937086610 2:119175987-119176009 AACCAAGCTTTTTATAACCTGGG - Intergenic
937815446 2:126245398-126245420 ATTAAAGCATTAAATCTCCTGGG - Intergenic
939597197 2:144139956-144139978 AAAATATTTTTTAATCACCTTGG + Intronic
939788018 2:146540222-146540244 ATAAAAGCTTTTAATCACCTGGG - Intergenic
940180516 2:150927024-150927046 AAGAAAGCAGTTAATTACCTGGG - Intergenic
940382185 2:153027980-153028002 AATAAAGTTCTTCATCTCCTTGG - Intergenic
940529866 2:154867654-154867676 ATAAAAGCTTTTAATCACTTGGG - Intergenic
940530898 2:154874490-154874512 ATAAAAGCTTTTAATCACCTGGG - Intergenic
940726670 2:157343116-157343138 AATAAACTTTTTAATCACCTGGG + Intergenic
940754050 2:157661239-157661261 TATAAGGCTTTTTATCATCTGGG - Intergenic
941062859 2:160867829-160867851 AACAATGCTTATAATCACTTAGG + Intergenic
941264624 2:163345104-163345126 AATAAAGATTTAAATAACTTGGG - Intergenic
941455276 2:165707599-165707621 AATAAAGTTTTTAATCACCTGGG + Intergenic
941456488 2:165715765-165715787 AATAAAGCTTTTAATCACCTGGG + Intergenic
941935355 2:170977505-170977527 AATAAAGCCTTTAATCACCTGGG + Intergenic
941936205 2:170983033-170983055 AATAAAGCGTTTAATCACCTGGG + Intergenic
942097666 2:172548689-172548711 AATAAAGCTTTTAATCACCTGGG - Intergenic
943104769 2:183530285-183530307 AATAAAGCTTTTAATCACCTGGG - Intergenic
943178857 2:184515641-184515663 ATGAAAGTTTTTAATCATCTGGG - Intergenic
943421093 2:187670530-187670552 AATATAGCTTTTAATCACTTGGG + Intergenic
943758280 2:191581865-191581887 ATTAAAAATTTTAATCACATAGG - Intergenic
943865099 2:192918652-192918674 CATAAAGCTTTTAATCACCTGGG - Intergenic
943960527 2:194256789-194256811 AATAAATTTTTAAGTCACCTAGG - Intergenic
945222639 2:207500512-207500534 AAAAATGTTTTTAATTACCTGGG + Intergenic
945360813 2:208894098-208894120 AATAAAGCTTTTAATCACCTGGG - Intergenic
945362176 2:208905398-208905420 AATAAAGCTTTTAATCACCTGGG - Intergenic
945554453 2:211262109-211262131 ATAAAGCCTTTTAATCACCTGGG - Intergenic
945769144 2:214018272-214018294 AAAAAAACTTTAAATCACCCAGG + Intronic
945858694 2:215095960-215095982 AATAAAGCTTTTAATCACCTGGG - Intronic
946886990 2:224230917-224230939 AATAAAGCTTTTAATCACCTGGG - Intergenic
946985592 2:225269137-225269159 AATAAAGATTTAAATCAACAGGG + Intergenic
947184682 2:227444531-227444553 AATAAAGCTTTCAATCACCTGGG + Intergenic
947487731 2:230567898-230567920 AATAAAGTTATAAATCAGCTGGG + Intergenic
947617878 2:231569821-231569843 ATAACAGCTTTTAATCACCTGGG - Intergenic
948144771 2:235700089-235700111 AACAAAACTTGTTATCACCTTGG + Intronic
948616532 2:239202785-239202807 GAAAAAGCTTTTCATCACCCAGG + Intronic
1169458943 20:5777758-5777780 AAGAAAGCTTTTTCTAACCTGGG + Intronic
1169798614 20:9492824-9492846 ACTACGGCTTTTAAACACCTGGG - Intergenic
1169991706 20:11511907-11511929 AATGAAACTTTGAATCACCTGGG + Intergenic
1170096552 20:12651603-12651625 AGCACAGCTTTTAATCAACTTGG + Intergenic
1170105782 20:12753323-12753345 AATAAAGCTTTTAATCACCTGGG - Intergenic
1170257760 20:14364063-14364085 AAACCACCTTTTAATCACCTGGG - Intronic
1170439473 20:16364049-16364071 TACAAAGCTTTAAATCATCTGGG + Intronic
1170807379 20:19644340-19644362 AATAAACCCTTGAGTCACCTGGG + Intronic
1172706963 20:36889058-36889080 AATAAAGCTCTTAACCCCATGGG + Intronic
1173026328 20:39310723-39310745 AATGAGGTTTTTAATCACATGGG + Intergenic
1174433967 20:50492043-50492065 AAAAAAAGTTTTAATTACCTGGG + Intergenic
1175078646 20:56398407-56398429 AAAAATTCTTTTAATCAGCTGGG + Intronic
1175103004 20:56593480-56593502 ATAAAACTTTTTAATCACCTGGG + Intergenic
1176336044 21:5601172-5601194 ATAAAAGCTTTTAATCACCTGGG + Intergenic
1176391713 21:6219776-6219798 ATAAAAGCTTTTAATCACCTGGG - Intergenic
1176469706 21:7096398-7096420 ATAAAAGCTTTTAATCACCTGGG + Intergenic
1176493267 21:7478176-7478198 ATAAAAGCTTTTAATCACCTGGG + Intergenic
1176507375 21:7660207-7660229 ATAAAAGCTTTTAATCACCTGGG - Intergenic
1176905594 21:14496765-14496787 AAGAAAGCATATAATAACCTAGG + Intronic
1177080324 21:16631383-16631405 AATAAAGATTTTAATCACCTGGG - Intergenic
1177119247 21:17121822-17121844 AATAAAGCTTTTAATCACCTGGG - Intergenic
1178151369 21:29798186-29798208 AATAAAGCTTATTATCAGGTTGG - Intronic
1178947178 21:36958363-36958385 AATAAAGCTTTTATTAACCTAGG - Intronic
1179072811 21:38088763-38088785 AAAAAAACTTGTGATCACCTAGG - Intronic
1179096185 21:38317317-38317339 AATAAATCTATTAATCAATTTGG - Intergenic
1179802658 21:43818363-43818385 AAAAAAGGTTTTAATTAGCTGGG - Intergenic
1180594854 22:16966468-16966490 AACGAAACTTTTGATCACCTTGG + Intronic
1181618765 22:24073028-24073050 AATAAAGCCATGAATCACCATGG + Intronic
1182215098 22:28709583-28709605 AATAAAGCTAATATTAACCTGGG - Intronic
949818731 3:8091756-8091778 AATTAAGTAATTAATCACCTAGG - Intergenic
950629421 3:14272384-14272406 AGTAAAGCTTTTAATCACCTGGG + Intergenic
950926167 3:16744611-16744633 AATAAAGCTTTTAATCACCTGGG - Intergenic
950926988 3:16749995-16750017 AATAAAGTTTTTAATCACCTGGG - Intergenic
952343823 3:32466557-32466579 AATAAAGCTTTTAATCACCTGGG + Intronic
952602293 3:35099943-35099965 AAAAAAGATTTTACTGACCTGGG - Intergenic
952894698 3:38070544-38070566 ATAAAAGCTTTTAATCACCTGGG + Intronic
953712507 3:45286421-45286443 GATACACATTTTAATCACCTGGG + Intergenic
953862538 3:46557427-46557449 AATAAAGCTTTTAATCACCTGGG - Intronic
954077553 3:48192309-48192331 AATAAAATTTTTAATTAGCTAGG - Intergenic
954484349 3:50833045-50833067 AAGAAAGCTTTTCATGAACTGGG + Intronic
955253088 3:57304193-57304215 AATAAAGCTTTTAATCACCTGGG - Intronic
955256913 3:57341687-57341709 ATTGAATCTTTTGATCACCTTGG - Intronic
955381363 3:58440964-58440986 AATAAAGCTTTTAATCACCTGGG + Intergenic
956358304 3:68418190-68418212 AATAAAGCTTTTAATCACCTGGG + Intronic
956444720 3:69314536-69314558 AAAAAAGCCTTTATTCAGCTGGG + Intronic
956696875 3:71925901-71925923 ATAAAAGCTTTTAATCACCTGGG - Intergenic
957127197 3:76176947-76176969 AATAAAGCTTTTAATAATAAGGG - Intronic
957882592 3:86239431-86239453 AATAAATCTTTTTTTCCCCTGGG + Intergenic
958936708 3:100263053-100263075 AATAAAGCTTTTAATCACCTGGG + Intronic
959038192 3:101389100-101389122 AATAAATCTTTTGCTCAACTTGG - Intronic
959485277 3:106922816-106922838 AATAAAGCTTTTAATCACCTGGG + Intergenic
959486068 3:106928030-106928052 AATAAAGCTTTTAATCACCTGGG + Intergenic
959539269 3:107522515-107522537 AAGAAAGGCTTTTATCACCTTGG - Intergenic
959688762 3:109176449-109176471 AATAAAGCTTTTAATCACCTGGG + Intergenic
959970132 3:112400129-112400151 AATAAAGGTTTTAATCACCTGGG - Intergenic
960061914 3:113331571-113331593 AATAAACCTTTAAATCACTAAGG + Intronic
960108436 3:113822214-113822236 AAAAAATCTTTTAATTAACTGGG - Intergenic
960126194 3:114000810-114000832 AAAAAAAATTTTAATCATCTGGG - Intronic
960345885 3:116532120-116532142 AATAAAGCTCTTAAACAGGTTGG + Intronic
961343759 3:126247699-126247721 ATAAAACTTTTTAATCACCTGGG - Intergenic
962768829 3:138593856-138593878 AGTAAAGCTTAGAATCACGTCGG - Intronic
963058273 3:141205237-141205259 AATAAAGCTTTTAATCACCTGGG - Intergenic
963059275 3:141211660-141211682 AATAAAGCTTTTAATCACCTGGG - Intergenic
963424922 3:145113401-145113423 AATAAAGCTTTTAATCACCTGGG - Intergenic
963522128 3:146367904-146367926 AATAAAGCTTTTAATCACTTGGG - Intergenic
963990872 3:151652337-151652359 TATAAATCTTCTAATCATCTTGG + Intergenic
964023602 3:152044251-152044273 AATATGCCTTTGAATCACCTGGG - Intergenic
964124900 3:153226197-153226219 AATAAAGCTTTTAATCACCTGGG + Intergenic
964125807 3:153232158-153232180 AATAAAGCTTTTTATCACCTGGG + Intergenic
964906058 3:161721962-161721984 AATAAAGCTTTAAATCACCTGGG + Intergenic
964906877 3:161727418-161727440 AATAAAGCTTTTAATCACCTGGG + Intergenic
964984453 3:162722865-162722887 AATAAAGCTTTTAATCACCTGGG + Intergenic
965104758 3:164342228-164342250 AACAAAGCTTTTAATCACCCGGG + Intergenic
965105528 3:164347488-164347510 AATAAAGCTTTTAATCACCTGGG + Intergenic
965196623 3:165605508-165605530 AATAAAGTTTCAAAACACCTGGG - Intergenic
965215725 3:165861944-165861966 AAGAAACCTTTTAATCATTTAGG + Intergenic
965626660 3:170688854-170688876 AATAAAGCTTTCAATCATCTGGG + Intronic
965640374 3:170823403-170823425 AATAAAGCTTTTAATCACCTGGG + Intronic
966066484 3:175827864-175827886 ATAAAAGCTTTTAATCACCTGGG - Intergenic
966067715 3:175836151-175836173 ATAAAAGCTTTTAATCACCTGGG - Intergenic
966168675 3:177052003-177052025 AATAAGCCTTTTTATCAGCTCGG - Intronic
966307876 3:178557203-178557225 GATACAGATTTGAATCACCTGGG - Intronic
967151813 3:186658101-186658123 AATAAATCTTTTAATCACCTGGG - Intergenic
967152612 3:186663621-186663643 AATAAAGCTTTTAATCACCTGGG - Intronic
967443082 3:189531478-189531500 AATAAAGCTTTTAATCTCTTGGG + Intergenic
967495924 3:190144938-190144960 AATAAAGCTTTTAATCACCGGGG - Intergenic
967496717 3:190150133-190150155 AATAAAGCTTTTAATCACCTGGG - Intergenic
967644143 3:191900749-191900771 AATAAAGCTTTTGATCACCTGGG + Intergenic
967740174 3:192995987-192996009 AACAAACCTTTTAATCACCCAGG - Intergenic
967740949 3:193001319-193001341 AATAAAGCTTTTAATCATCTGGG - Intergenic
968221803 3:196945306-196945328 AAAAAAGTTTTTAATTAGCTGGG - Intergenic
968277261 3:197449913-197449935 CAGAAAGCTTTTAATCACAGTGG + Intergenic
969128005 4:4968353-4968375 AATAAACCTTTTGATTCCCTTGG + Intergenic
969598276 4:8161059-8161081 AATAAACCTTTAAAGGACCTTGG - Intergenic
970041802 4:11806674-11806696 AATAAAACTTTTAATCACCTGGG - Intergenic
970042538 4:11811869-11811891 AATAAAGCTTTTAATCACCTGGG - Intergenic
970063076 4:12057677-12057699 AATAAAGCATTGAATCTCTTAGG - Intergenic
970853512 4:20629818-20629840 AATAAAGCTTTTAATCACCTGGG + Intergenic
970854360 4:20635616-20635638 AATAAAGCTTTTAATCACCTGGG + Intergenic
970916705 4:21344275-21344297 CATGAAGCTTTTATTCTCCTTGG - Intronic
971002267 4:22336920-22336942 AATAAAGCTCTTAATGACAGTGG - Intergenic
971122795 4:23722920-23722942 AATAAAGCTTTTAATCACCTGGG + Intergenic
971123527 4:23727467-23727489 AATAAAGCTTTTAATCACCTGGG + Intergenic
971159532 4:24119893-24119915 AATAAAGCTTTTAAGATTCTAGG - Intergenic
971495334 4:27258468-27258490 CCTAAACCTTTTAATTACCTCGG + Intergenic
971713748 4:30149840-30149862 AATAAAGCTTTTAATCACCTGGG - Intergenic
971713885 4:30150918-30150940 AATAAAGCTTTTAATCACTTGGG - Intergenic
972159498 4:36205876-36205898 ATTAAAGCTTTTTATTTCCTTGG + Intronic
972350209 4:38229857-38229879 AATATTGCTTTTAAGAACCTAGG - Intergenic
973881792 4:55280397-55280419 AGTAAAGCTTCTAATCACCTGGG + Intergenic
974593413 4:63984983-63985005 AATAAAGCTTTTAATCACCTGGG + Intergenic
975636614 4:76456758-76456780 AATAAAGCTTTTAATCACCTGGG + Intronic
976087507 4:81421174-81421196 AATAAAGCTTTTAATCACCTGGG - Intergenic
976147922 4:82061176-82061198 AATATAGCTTTTAATTCCCAAGG + Intergenic
976157677 4:82164820-82164842 GATAAAAGTTTTAATTACCTAGG + Intergenic
976552786 4:86415434-86415456 AATAGAGCTTTTGATAACTTAGG + Intronic
976585873 4:86796478-86796500 AAAAAAATTTTTAATTACCTGGG + Intronic
976637987 4:87307347-87307369 AATAATTGTTTTTATCACCTTGG + Intronic
976696214 4:87922183-87922205 AATAAAGCTTTTAATCACCTGGG - Intergenic
976697670 4:87935969-87935991 AATAAAGCTTTTAATCACCTGGG + Intergenic
976783328 4:88786697-88786719 AATATAGCTCTTAAACATCTCGG + Intronic
977206115 4:94166889-94166911 AATAAAGTTTTTAATCACCTGGG + Intergenic
977767798 4:100821017-100821039 AGCAAAGATTTTAATCACCTTGG + Intronic
978303476 4:107295523-107295545 AATAAAGATTTTAATCACCTGGG + Intergenic
979850637 4:125567055-125567077 AATAAAGCTTTTAATCACCTGGG + Intergenic
980002841 4:127511085-127511107 AATAAAGCTTTTAATCACCTGGG + Intergenic
980003656 4:127516801-127516823 AGTAGAGCTTTTAATCACCTGGG + Intergenic
980111423 4:128640941-128640963 AATAAAGCTTTTAATCACCTGGG + Intergenic
980416244 4:132492391-132492413 AATAAAGCTTTTAATCACCTAGG - Intergenic
980416479 4:132495618-132495640 AATAAAGCTTTTAATTACCTCGG - Intergenic
980471912 4:133263610-133263632 AATAAAGCTTTTAATCACATGGG + Intergenic
980527573 4:134012551-134012573 AATAAAGCTTTTAATCACCTGGG - Intergenic
980528404 4:134018311-134018333 AATAAAGCTTTTAATCACCTGGG - Intergenic
980592900 4:134914641-134914663 AATAAAGCTTTTAATCACCTGGG - Intergenic
981040728 4:140219124-140219146 AATAAAGCTTTTAATCACCTGGG - Intergenic
981259309 4:142700892-142700914 AATAAATGTTTAAATCATCTGGG - Intronic
981524820 4:145699203-145699225 AATAAAGCTTTTAATCACCTGGG - Intronic
981525544 4:145703434-145703456 AATAAAGCTTTTAATCACCTGGG - Intronic
982397034 4:154924202-154924224 AATAAAGCTTTTAATCATCTGGG + Intergenic
982497446 4:156108944-156108966 AATAAAGCTTTTAATCACCTGGG + Intergenic
982708284 4:158734644-158734666 ATTAATGCTTTTAGTGACCTAGG - Intergenic
983255668 4:165397348-165397370 AATAAATCATTTAATCTCTTTGG - Intronic
983447757 4:167876640-167876662 AATAAATCTTTTAAACACCTGGG - Intergenic
983448541 4:167881952-167881974 AATAAAGCTTTTAATCACCTGGG - Intergenic
983460315 4:168018641-168018663 AATAAAGCTTTTAATCACCTGGG + Intergenic
983659267 4:170116769-170116791 AATAAAGCTTTTAATCACCTGGG - Intergenic
983660049 4:170122089-170122111 AATAAAGCTTTTAATCACCTGGG - Intergenic
984456125 4:179971359-179971381 AATAAAAATGTTGATCACCTGGG - Intergenic
984568671 4:181363343-181363365 AAAATAGCTTTTAATATCCTAGG + Intergenic
984676906 4:182559679-182559701 AATAAAGCTTAAAATGACCGTGG - Intronic
985389391 4:189479586-189479608 AATAAAGCTTTTAATCACCTGGG + Intergenic
986019529 5:3788422-3788444 ATAAAAGCTTTTAATCACCTGGG + Intergenic
986388460 5:7262673-7262695 AATAAAGCTTTTAATCACCTGGG - Intergenic
986388565 5:7263959-7263981 AATAAAGCTTTTAATCACCTGGG - Intergenic
986389373 5:7269262-7269284 AATAAAGCTTTTAATCACCTGGG - Intergenic
986858167 5:11895911-11895933 AATAAAACTTCTAATTACATAGG - Intronic
987212941 5:15702785-15702807 AATAAAGCTTTTAATCACCTGGG + Intronic
987299197 5:16581647-16581669 AATATTGCTTCTAATCACTTGGG - Intronic
987617673 5:20297572-20297594 GATAAAGCTTTTTATGGCCTTGG - Intronic
987978772 5:25052398-25052420 AATATAAATTTTAATCCCCTTGG - Intergenic
988008090 5:25445870-25445892 AATAAAGCTTTTAATCACCTGGG + Intergenic
989659685 5:43786789-43786811 ATAAAGCCTTTTAATCACCTGGG - Intergenic
989768289 5:45112485-45112507 AATAAAGCTTTTAATCACCTGGG + Intergenic
991468113 5:66936408-66936430 AATAAAGCTTTTAATCACCTGGG + Intronic
992515788 5:77491380-77491402 ATAAAAGCTTTTAATCACCTGGG - Intronic
992578574 5:78146751-78146773 AATAAAGCATTTTATTTCCTGGG + Intronic
992787694 5:80185552-80185574 ATAAAAGCTTTTAATCACCTGGG + Intronic
993368584 5:87063291-87063313 AAAAAAGCTAATAATCATCTTGG + Intergenic
994065128 5:95530981-95531003 AATAAATCATTTAATCACATAGG + Intronic
994209947 5:97076177-97076199 AATAAAGCTGAGAATCACCTGGG - Intergenic
994239031 5:97399000-97399022 AATAAAGCTTTTAATCACCTGGG + Intergenic
994604828 5:101954128-101954150 AATAAAGGTTTTTGTCCCCTGGG + Intergenic
995296570 5:110531262-110531284 AATAAAGCTTTTAATCACCTGGG - Intronic
995297131 5:110535444-110535466 AATAAAGCTTTTAATCACCTGGG - Intronic
995883414 5:116867481-116867503 AATAAAGCTTTTAATCACCTGGG + Intergenic
995890488 5:116945675-116945697 AATAAAGCTTTTAATCACCTGGG + Intergenic
995949539 5:117693726-117693748 AGCAAATCTTTTATTCACCTAGG + Intergenic
996377132 5:122822900-122822922 AATAAAGCGTTTAAACCCCTTGG - Intronic
996510379 5:124309407-124309429 AATAAAGCTTTTAATCACGTGGG - Intergenic
996527746 5:124497374-124497396 AATAAAGCTTTTAATCACCTGGG - Intergenic
996528522 5:124502670-124502692 AATAAAGCTTTTAATCACCTGGG - Intergenic
996827800 5:127704880-127704902 AATAAATCATTTATTCACCCAGG + Intergenic
999882699 5:155884175-155884197 AAGAGAGCTGTGAATCACCTCGG - Intronic
999950963 5:156649920-156649942 AACAAAGCTTTTCATTACCTGGG + Intronic
1000127999 5:158266219-158266241 AGTAAAGCTGTTAATTACCTGGG + Intergenic
1000439099 5:161246131-161246153 AATAAAGCTTTAAATCACCTGGG - Intergenic
1001287338 5:170433491-170433513 CATAAAGCTTTTAAAAACATTGG - Intronic
1003429680 6:6027857-6027879 AATAAAGCTTTTAATCACCTGGG + Intergenic
1003430510 6:6033234-6033256 AATAAAGCTTTTAATCACCTGGG + Intergenic
1003882741 6:10493259-10493281 AATAAAGATTTTCACCACGTTGG + Intronic
1004283020 6:14296989-14297011 AATAAAGCTTTTAATCACCTGGG + Intergenic
1004283874 6:14302425-14302447 AATAAAGCTTTTAATCACCTGGG + Intergenic
1005785841 6:29245526-29245548 AATAAAGCTTTTAATCACCTGGG + Intergenic
1006028106 6:31160051-31160073 AATAATGTTTTTAATAATCTGGG + Intronic
1006482173 6:34304818-34304840 AAAAAAGTTTTTAATTAGCTGGG - Intronic
1006777384 6:36606151-36606173 AAAAAAGTTTTTAATTAGCTGGG - Intergenic
1006783810 6:36651172-36651194 CATAACTCCTTTAATCACCTTGG - Intergenic
1008221664 6:48862015-48862037 CATAAAGCTTGTGATCAGCTGGG - Intergenic
1008853230 6:56050285-56050307 AATAATGCTTTTATTTATCTTGG - Intergenic
1009343303 6:62586311-62586333 AACAAAGCTTTTAATCACCTGGG - Intergenic
1009344068 6:62591655-62591677 AATAAAGCTTTTAATCACCTGGG - Intergenic
1009359839 6:62797381-62797403 AATACACTTTTTAATCACCTGGG - Intergenic
1009840490 6:69066963-69066985 GATAAAGATGTTATTCACCTTGG - Intronic
1010498267 6:76562627-76562649 AATAAAGCTTTTAATCACCTGGG - Intergenic
1011487882 6:87861909-87861931 AATAAAGCTTTTAATCACCAGGG + Intergenic
1011582026 6:88879059-88879081 AAGCAAGCTATTAACCACCTGGG + Intronic
1011786617 6:90853815-90853837 AATTAATCTTTTAAAAACCTTGG + Intergenic
1011860300 6:91746900-91746922 CATAAAGCTTTTAGTGACCAGGG + Intergenic
1012158952 6:95858359-95858381 AATAGAGCTTTTAATTATTTTGG - Intergenic
1012815150 6:104014596-104014618 AATATAGCTGTTAGTCATCTGGG + Intergenic
1014177630 6:118348054-118348076 AGTAAGGCTTTTGGTCACCTGGG + Intergenic
1015212316 6:130712223-130712245 AATAAAGCTTTTAATCACCTGGG - Intergenic
1015324319 6:131907348-131907370 AATAAAGCTTTTAATCACCTGGG - Intergenic
1015800753 6:137060334-137060356 AATAAAGCTTTTAATCACCTGGG + Intergenic
1015801713 6:137066760-137066782 AATAAAGCTTTTAATCACCTGGG + Intergenic
1015931658 6:138366818-138366840 AAAAAGCTTTTTAATCACCTGGG + Intergenic
1016180223 6:141136809-141136831 ATTAAAACTTTTTATCATCTAGG - Intergenic
1016204224 6:141453155-141453177 AATAAAGCTTTTAATCACCTGGG - Intergenic
1016205319 6:141460611-141460633 AATAAAGCTTTTAATCACCTGGG - Intergenic
1016233121 6:141830328-141830350 AATAAAGCTTTTAATTACCTGGG - Intergenic
1016341360 6:143064858-143064880 AATAAAGCTTTTAATTCACCTGG + Intronic
1016535271 6:145103233-145103255 AACAAAGCTTTTAATTACCTGGG + Intergenic
1016536062 6:145108506-145108528 AATAAAGCTTTTAATCACCTGGG + Intergenic
1016700477 6:147048576-147048598 AATAAACCTTTTCATACCCTTGG + Intergenic
1016852947 6:148640110-148640132 AATAAAGCTTTTAATCACCTGGG - Intergenic
1016853754 6:148645439-148645461 AATAAAGCTTTTAATCACCTGGG - Intergenic
1017580736 6:155862077-155862099 ATTAAAGATTTAATTCACCTTGG - Intergenic
1017856590 6:158355241-158355263 AATAATTATTTTAATTACCTGGG - Intronic
1017979430 6:159386665-159386687 ACTAAATCTTTTAATAAACTGGG + Intergenic
1018494910 6:164338816-164338838 AATAAAGCTTTTAATCACCTGGG + Intergenic
1018495790 6:164344418-164344440 AATAAAGCTTTTAATCACCTGGG + Intergenic
1019106788 6:169674787-169674809 AATAAAGCTTTTAATCACCTGGG + Intronic
1020490923 7:8783024-8783046 AATAAAGCTTTTAATCACCTGGG - Intergenic
1020540539 7:9457749-9457771 AATAAAGCTTTTAATCACCTGGG + Intergenic
1020541427 7:9463816-9463838 AATAAAGCTTTTAATCACCTGGG + Intergenic
1022447963 7:30485211-30485233 ACTAAGTTTTTTAATCACCTGGG - Intergenic
1022565499 7:31396019-31396041 AAAAAAGCATATAATCATCTTGG - Intergenic
1022677690 7:32514864-32514886 AATAAAGCTTTTAATCACCTGGG - Intronic
1022709590 7:32838202-32838224 AATAAAGCTTTTAATCACCTGGG - Intergenic
1023698388 7:42870623-42870645 AATAAAGCTTTTAATCACCTGGG + Intergenic
1023699211 7:42875971-42875993 AATAAAGCTTTTAATCACCTGGG + Intergenic
1024415573 7:49101424-49101446 AATAAAGCTTTTAATCACCTGGG - Intergenic
1024918447 7:54530653-54530675 AAGAACGTTTTTAGTCACCTTGG + Intergenic
1024938911 7:54741842-54741864 ATTAAAGATTTTACTCTCCTAGG + Intergenic
1027960075 7:84934445-84934467 AATGAAGTTTTTAAGCACATTGG - Intergenic
1028449794 7:90968685-90968707 AATAAAGTTTTTAATCTGTTGGG - Intronic
1029500754 7:100927963-100927985 AATAACGCTTTTAATCACCTGGG - Intergenic
1029876497 7:103758451-103758473 AAAAAAGCTTTTAAAAACCCTGG - Intronic
1030294227 7:107904508-107904530 ATTAAAAAGTTTAATCACCTAGG - Intronic
1030496102 7:110302737-110302759 ATTATAGCTTTTATCCACCTTGG + Intergenic
1030806431 7:113925778-113925800 TATACAGATTTTAGTCACCTAGG + Intronic
1030958215 7:115881928-115881950 AATAATGCTTGGAACCACCTTGG + Intergenic
1031283691 7:119838728-119838750 AATAAAGTTTTTAATCACCTGGG + Intergenic
1031364295 7:120885747-120885769 AATAAAGCTTTTAATCACCTGGG + Intergenic
1031365061 7:120891031-120891053 AATAAAGCTTTTAATCACCTGGG + Intergenic
1031421927 7:121563697-121563719 ATAAAAGCTTTTAATCACCTGGG + Intergenic
1031727526 7:125259257-125259279 GATAAAGCTTTTAATCACCTGGG - Intergenic
1031776008 7:125910344-125910366 AATAAAGCTTTTAATCACCTGGG - Intergenic
1031776805 7:125915670-125915692 AATAAAGCTTTTAATCACCTGGG - Intergenic
1031777007 7:125917896-125917918 AATAAGGCTTTCAATCACCTGGG - Intergenic
1031777938 7:125924041-125924063 AATAAAGCTTTTAATCACCTGGG - Intergenic
1033909812 7:146248863-146248885 ATAAAAGCTTTTAATCACCTGGG + Intronic
1036486651 8:9185409-9185431 ATGAAAGCTTTTAATCACTTGGG - Intergenic
1037455843 8:19063195-19063217 AATCAATCTTTTATTAACCTGGG + Intronic
1037902949 8:22698506-22698528 AAAAAAGTTTTTAATTAGCTGGG - Intergenic
1038460934 8:27716150-27716172 AAAAAAGTTTTTAATTAGCTGGG + Intergenic
1038721054 8:30035597-30035619 AATAAAGCTTTTAATCACCTGGG - Intergenic
1039180401 8:34860234-34860256 AATAAAGCTTTTAATCACCTGGG + Intergenic
1040062604 8:43116850-43116872 AATAAAGCATTTAATCACCTGGG + Intronic
1040530387 8:48261769-48261791 ATAAAAGCTTTTAATTGCCTGGG + Intergenic
1040946654 8:52892164-52892186 AATAATTCTTTTAACCACCTAGG + Intergenic
1041247078 8:55898583-55898605 AATAAAACTATTATTCAGCTGGG - Intronic
1041303833 8:56439366-56439388 AATAAAGCTTTTAATCATCTGGG - Intronic
1041437673 8:57860400-57860422 AAAAAATTTTTTAATCAGCTAGG + Intergenic
1041983259 8:63888540-63888562 AATAAAGCTTTTAATCACCTGGG - Intergenic
1042273867 8:66982935-66982957 AAAAAAGCTTTTAATTATCCAGG - Intronic
1042336221 8:67632329-67632351 AAAAAAGTTTTTAATTAGCTGGG - Intronic
1042345213 8:67720014-67720036 AATAAAGCTTTTAATCACCTGGG + Intronic
1042828076 8:72998255-72998277 ATAAAGGTTTTTAATCACCTGGG - Intergenic
1044229210 8:89756206-89756228 AATAAAGCTTTTAATCATGTGGG - Intergenic
1044531358 8:93310978-93311000 AATACAGATGTTAATGACCTTGG + Intergenic
1044833027 8:96268747-96268769 AATCAAGTTTTCAAACACCTTGG - Intronic
1045475892 8:102551949-102551971 AGTAAAGCTTATAATCACACAGG - Exonic
1045991133 8:108309804-108309826 AATAAAGCTTTTAATCACCTGGG + Intronic
1046207911 8:111027108-111027130 AATAAAGCTACTAAGAACCTAGG - Intergenic
1046440505 8:114247014-114247036 AATAAAGCTTTTAATCACCTGGG - Intergenic
1046520160 8:115314487-115314509 AATAAACTTCTTAATAACCTAGG + Intergenic
1047654073 8:126956804-126956826 AATAAAACATTTTACCACCTGGG + Intergenic
1048097288 8:131310495-131310517 AATAAAGTTTTTAATCACCTGGG - Intergenic
1048135166 8:131741082-131741104 AATAAAGCTTTTAATCAACTGGG - Intergenic
1048135966 8:131746553-131746575 AATAAAGCTTTTAATCACTTGGG - Intergenic
1048144297 8:131825036-131825058 AATAAAGCTTTTAATCACCTGGG - Intergenic
1048668125 8:136687252-136687274 AATAAAGCTTTTAATCACCTGGG - Intergenic
1050117302 9:2276036-2276058 AATGAAGCTTTTAATCACCTGGG - Intergenic
1050118150 9:2281455-2281477 AAAAAAGCTTTTAGTCACCTGGG - Intergenic
1050251557 9:3750023-3750045 AATAAAGCTTTTAATCACCTGGG - Intergenic
1050282334 9:4063512-4063534 AATAGAGCTTTTAAAGCCCTTGG + Intronic
1050814280 9:9789491-9789513 TTTAAAAGTTTTAATCACCTAGG - Intronic
1050863265 9:10464258-10464280 AATAAAGATTTTAAAAAGCTGGG + Intronic
1051116513 9:13700210-13700232 AATAAATCTATAAATTACCTTGG - Intergenic
1051605355 9:18912835-18912857 AAAAAAATTTTTAATTACCTGGG + Intergenic
1052654184 9:31334628-31334650 AATAAAGCTTTTAATCACCTGGG - Intergenic
1052720132 9:32164409-32164431 AATAAAGCTTTTAATCACCTGGG + Intergenic
1053077979 9:35151273-35151295 AAAAAACTGTTTAATCACCTGGG + Intergenic
1055809720 9:80137672-80137694 AATAAAGCTTTTAATCACCTGGG - Intergenic
1055922438 9:81475158-81475180 AATAAAGCATTTAAACTCTTTGG + Intergenic
1056323499 9:85458704-85458726 AATAAAGCTTTTAATCACCTGGG - Intergenic
1056324747 9:85466875-85466897 AATAAAGCTTTTAATCACCTGGG - Intergenic
1056363163 9:85879281-85879303 ATAAAACTTTTTAATCACCTGGG + Intergenic
1056543131 9:87591598-87591620 AAAAAAATTTTTAATCACCCTGG - Intronic
1056971260 9:91206091-91206113 ATGAAAACTTTTTATCACCTTGG + Intergenic
1058029118 9:100176279-100176301 AAAAAAGGTTTTAATAACCTTGG + Intronic
1058250568 9:102690333-102690355 AATGAAACTATAAATCACCTAGG + Intergenic
1060737349 9:126074497-126074519 AATAAAGCTTTTAATCACCTGGG + Intergenic
1060738217 9:126080065-126080087 AATAAAGATATTAATCACCTGGG + Intergenic
1203425598 Un_GL000195v1:33730-33752 ATAAAAGCTTTTAATCACCTGGG - Intergenic
1203548539 Un_KI270743v1:150283-150305 AAAAAATTTTTTAATTACCTGGG + Intergenic
1185492653 X:529668-529690 ATAAAACTTTTTAATCACCTGGG + Intergenic
1185751967 X:2618632-2618654 AATAAAGTATTTAGTCACGTGGG + Intergenic
1186112364 X:6272267-6272289 AATAAAGCTTTTAATCACCTGGG + Intergenic
1186113213 X:6277582-6277604 AATAAAGCTTTTAATCACCTGGG + Intergenic
1186721568 X:12310074-12310096 AATAAAGCTTTTAATCACCTGGG + Intronic
1186979890 X:14947473-14947495 AAGCAAGCTTTTAAACATCTAGG + Intergenic
1187086848 X:16050063-16050085 AATAAAGCTTTTAATCACCTGGG + Intergenic
1187099494 X:16179249-16179271 AATAAAGCTTTTAATCACCTGGG + Intergenic
1187100207 X:16184076-16184098 AATAAAGCTTTTAATCACCTGGG + Intergenic
1187491855 X:19759590-19759612 ATTAAAGCTTTTAGACAGCTGGG + Intronic
1187636095 X:21230014-21230036 AATAAATCTATAAATTACCTTGG + Intergenic
1188024426 X:25193986-25194008 AAAAAAGCTTTCAATTACTTGGG - Intergenic
1188059062 X:25577666-25577688 ATAAAACTTTTTAATCACCTGGG - Intergenic
1188807195 X:34605986-34606008 AAAAAATCTTTTAATTACATTGG + Intergenic
1191161841 X:57338112-57338134 ATAAAAGCTTTTAATCACCTGGG + Intronic
1191603036 X:63031723-63031745 ACTAAAGCTATTTATCACCAAGG - Intergenic
1191762186 X:64657596-64657618 AATAAAGCTTTTAATCACCTGGG - Intergenic
1194060597 X:89191900-89191922 AATAAAGCTTTTAATCACCTGGG - Intergenic
1194660370 X:96624358-96624380 AATAAAGCTTTTAATCACCTGGG - Intergenic
1194661274 X:96630379-96630401 AATAAAGCTTTTAATCACCTGGG - Intergenic
1194873211 X:99158769-99158791 AATAAAGCTTTTAATCACCTGGG + Intergenic
1194874129 X:99164834-99164856 AATAAAGCTTTTCATCACCTGGG + Intergenic
1195375344 X:104221333-104221355 GATAATGCGTTCAATCACCTGGG - Intergenic
1195841152 X:109178723-109178745 AATAAAGCTTTTAATCACCTGGG - Intergenic
1195841989 X:109184089-109184111 AATAAAGCTTTTAATCACCTGGG - Intergenic
1196026764 X:111049523-111049545 AATAAAGGTTTTAATTAAATTGG + Intronic
1196363215 X:114891804-114891826 AATATATCTTTTTATCAACTGGG + Intronic
1196503822 X:116416995-116417017 GATAAAACTTTTAATAAACTAGG - Intergenic
1196533056 X:116812495-116812517 AATAAAGCTTTTAATCACCTGGG + Intergenic
1196533852 X:116817821-116817843 AATAAAGCCTTTAATCACCTGGG + Intergenic
1197266506 X:124379736-124379758 AACATAGCTTTTATTAACCTGGG - Exonic
1197793770 X:130280121-130280143 ATAAAACTTTTTAATCACCTGGG - Intergenic
1198598113 X:138258990-138259012 AATAAAGCTTTTAATCACCTGGG - Intergenic
1199157122 X:144563390-144563412 AACAAAGTGTTTAATAACCTGGG + Intergenic
1200977310 Y:9227038-9227060 AATAAAGCATCTATTTACCTTGG - Intergenic
1201125863 Y:10913577-10913599 AGTCAAGCTTTACATCACCTGGG + Intergenic
1201607165 Y:15799771-15799793 AATAAAGCTTTTAATCACCTGGG + Intergenic
1201725049 Y:17141772-17141794 AATAAAGCTTTTAATCACCTGGG + Intergenic
1201725148 Y:17142557-17142579 AATAAAGCTTTTAACTACCTGGG + Intergenic
1201865237 Y:18645422-18645444 AATAAAGCTTTTAATCGCCTGGG - Intergenic
1201936115 Y:19412395-19412417 AATAAAGCTTTTAATCACCTGGG - Intergenic
1201937968 Y:19427669-19427691 AATAAAGCTTTTAATCACCTGGG - Intergenic
1202061815 Y:20896844-20896866 AAAAAACTTTTTAATCACCTGGG - Intergenic
1202075663 Y:21035967-21035989 AATAAAGCTTTTAATCACCTTGG + Intergenic
1202076863 Y:21044794-21044816 AATAAAGCTTTTAACCACCTGGG + Intergenic
1202133499 Y:21635853-21635875 AATAAAGCATCTATTTACCTTGG + Intergenic