ID: 1060738786

View in Genome Browser
Species Human (GRCh38)
Location 9:126083969-126083991
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060738786_1060738799 19 Left 1060738786 9:126083969-126083991 CCCAGGCCAGCCTGGCCTCCTGT No data
Right 1060738799 9:126084011-126084033 GGGCTGACAGGTTCTCTGCAGGG No data
1060738786_1060738800 24 Left 1060738786 9:126083969-126083991 CCCAGGCCAGCCTGGCCTCCTGT No data
Right 1060738800 9:126084016-126084038 GACAGGTTCTCTGCAGGGTCTGG No data
1060738786_1060738798 18 Left 1060738786 9:126083969-126083991 CCCAGGCCAGCCTGGCCTCCTGT No data
Right 1060738798 9:126084010-126084032 GGGGCTGACAGGTTCTCTGCAGG No data
1060738786_1060738795 -1 Left 1060738786 9:126083969-126083991 CCCAGGCCAGCCTGGCCTCCTGT No data
Right 1060738795 9:126083991-126084013 TGGCTGAGACTCCTTCATTGGGG No data
1060738786_1060738794 -2 Left 1060738786 9:126083969-126083991 CCCAGGCCAGCCTGGCCTCCTGT No data
Right 1060738794 9:126083990-126084012 GTGGCTGAGACTCCTTCATTGGG No data
1060738786_1060738793 -3 Left 1060738786 9:126083969-126083991 CCCAGGCCAGCCTGGCCTCCTGT No data
Right 1060738793 9:126083989-126084011 TGTGGCTGAGACTCCTTCATTGG No data
1060738786_1060738796 7 Left 1060738786 9:126083969-126083991 CCCAGGCCAGCCTGGCCTCCTGT No data
Right 1060738796 9:126083999-126084021 ACTCCTTCATTGGGGCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060738786 Original CRISPR ACAGGAGGCCAGGCTGGCCT GGG (reversed) Intergenic
No off target data available for this crispr