ID: 1060738791

View in Genome Browser
Species Human (GRCh38)
Location 9:126083984-126084006
Sequence GAAGGAGTCTCAGCCACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060738791_1060738800 9 Left 1060738791 9:126083984-126084006 CCTCCTGTGGCTGAGACTCCTTC No data
Right 1060738800 9:126084016-126084038 GACAGGTTCTCTGCAGGGTCTGG No data
1060738791_1060738798 3 Left 1060738791 9:126083984-126084006 CCTCCTGTGGCTGAGACTCCTTC No data
Right 1060738798 9:126084010-126084032 GGGGCTGACAGGTTCTCTGCAGG No data
1060738791_1060738799 4 Left 1060738791 9:126083984-126084006 CCTCCTGTGGCTGAGACTCCTTC No data
Right 1060738799 9:126084011-126084033 GGGCTGACAGGTTCTCTGCAGGG No data
1060738791_1060738796 -8 Left 1060738791 9:126083984-126084006 CCTCCTGTGGCTGAGACTCCTTC No data
Right 1060738796 9:126083999-126084021 ACTCCTTCATTGGGGCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060738791 Original CRISPR GAAGGAGTCTCAGCCACAGG AGG (reversed) Intergenic
No off target data available for this crispr