ID: 1060738792

View in Genome Browser
Species Human (GRCh38)
Location 9:126083987-126084009
Sequence AATGAAGGAGTCTCAGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060738792_1060738799 1 Left 1060738792 9:126083987-126084009 CCTGTGGCTGAGACTCCTTCATT No data
Right 1060738799 9:126084011-126084033 GGGCTGACAGGTTCTCTGCAGGG No data
1060738792_1060738798 0 Left 1060738792 9:126083987-126084009 CCTGTGGCTGAGACTCCTTCATT No data
Right 1060738798 9:126084010-126084032 GGGGCTGACAGGTTCTCTGCAGG No data
1060738792_1060738801 29 Left 1060738792 9:126083987-126084009 CCTGTGGCTGAGACTCCTTCATT No data
Right 1060738801 9:126084039-126084061 AGCTTTGTATTGTGTCCCCCTGG No data
1060738792_1060738800 6 Left 1060738792 9:126083987-126084009 CCTGTGGCTGAGACTCCTTCATT No data
Right 1060738800 9:126084016-126084038 GACAGGTTCTCTGCAGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060738792 Original CRISPR AATGAAGGAGTCTCAGCCAC AGG (reversed) Intergenic
No off target data available for this crispr