ID: 1060738798

View in Genome Browser
Species Human (GRCh38)
Location 9:126084010-126084032
Sequence GGGGCTGACAGGTTCTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060738792_1060738798 0 Left 1060738792 9:126083987-126084009 CCTGTGGCTGAGACTCCTTCATT No data
Right 1060738798 9:126084010-126084032 GGGGCTGACAGGTTCTCTGCAGG No data
1060738786_1060738798 18 Left 1060738786 9:126083969-126083991 CCCAGGCCAGCCTGGCCTCCTGT No data
Right 1060738798 9:126084010-126084032 GGGGCTGACAGGTTCTCTGCAGG No data
1060738789_1060738798 12 Left 1060738789 9:126083975-126083997 CCAGCCTGGCCTCCTGTGGCTGA No data
Right 1060738798 9:126084010-126084032 GGGGCTGACAGGTTCTCTGCAGG No data
1060738790_1060738798 8 Left 1060738790 9:126083979-126084001 CCTGGCCTCCTGTGGCTGAGACT No data
Right 1060738798 9:126084010-126084032 GGGGCTGACAGGTTCTCTGCAGG No data
1060738791_1060738798 3 Left 1060738791 9:126083984-126084006 CCTCCTGTGGCTGAGACTCCTTC No data
Right 1060738798 9:126084010-126084032 GGGGCTGACAGGTTCTCTGCAGG No data
1060738787_1060738798 17 Left 1060738787 9:126083970-126083992 CCAGGCCAGCCTGGCCTCCTGTG No data
Right 1060738798 9:126084010-126084032 GGGGCTGACAGGTTCTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060738798 Original CRISPR GGGGCTGACAGGTTCTCTGC AGG Intergenic
No off target data available for this crispr