ID: 1060738800

View in Genome Browser
Species Human (GRCh38)
Location 9:126084016-126084038
Sequence GACAGGTTCTCTGCAGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060738787_1060738800 23 Left 1060738787 9:126083970-126083992 CCAGGCCAGCCTGGCCTCCTGTG No data
Right 1060738800 9:126084016-126084038 GACAGGTTCTCTGCAGGGTCTGG No data
1060738790_1060738800 14 Left 1060738790 9:126083979-126084001 CCTGGCCTCCTGTGGCTGAGACT No data
Right 1060738800 9:126084016-126084038 GACAGGTTCTCTGCAGGGTCTGG No data
1060738791_1060738800 9 Left 1060738791 9:126083984-126084006 CCTCCTGTGGCTGAGACTCCTTC No data
Right 1060738800 9:126084016-126084038 GACAGGTTCTCTGCAGGGTCTGG No data
1060738786_1060738800 24 Left 1060738786 9:126083969-126083991 CCCAGGCCAGCCTGGCCTCCTGT No data
Right 1060738800 9:126084016-126084038 GACAGGTTCTCTGCAGGGTCTGG No data
1060738792_1060738800 6 Left 1060738792 9:126083987-126084009 CCTGTGGCTGAGACTCCTTCATT No data
Right 1060738800 9:126084016-126084038 GACAGGTTCTCTGCAGGGTCTGG No data
1060738789_1060738800 18 Left 1060738789 9:126083975-126083997 CCAGCCTGGCCTCCTGTGGCTGA No data
Right 1060738800 9:126084016-126084038 GACAGGTTCTCTGCAGGGTCTGG No data
1060738797_1060738800 -9 Left 1060738797 9:126084002-126084024 CCTTCATTGGGGCTGACAGGTTC No data
Right 1060738800 9:126084016-126084038 GACAGGTTCTCTGCAGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060738800 Original CRISPR GACAGGTTCTCTGCAGGGTC TGG Intergenic
No off target data available for this crispr