ID: 1060738801

View in Genome Browser
Species Human (GRCh38)
Location 9:126084039-126084061
Sequence AGCTTTGTATTGTGTCCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060738792_1060738801 29 Left 1060738792 9:126083987-126084009 CCTGTGGCTGAGACTCCTTCATT No data
Right 1060738801 9:126084039-126084061 AGCTTTGTATTGTGTCCCCCTGG No data
1060738797_1060738801 14 Left 1060738797 9:126084002-126084024 CCTTCATTGGGGCTGACAGGTTC No data
Right 1060738801 9:126084039-126084061 AGCTTTGTATTGTGTCCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060738801 Original CRISPR AGCTTTGTATTGTGTCCCCC TGG Intergenic
No off target data available for this crispr