ID: 1060743843

View in Genome Browser
Species Human (GRCh38)
Location 9:126117017-126117039
Sequence CAGGCTTAAGACTCTGCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060743842_1060743843 -8 Left 1060743842 9:126117002-126117024 CCTTTAGAAAGGCTTCAGGCTTA No data
Right 1060743843 9:126117017-126117039 CAGGCTTAAGACTCTGCATTAGG No data
1060743841_1060743843 -7 Left 1060743841 9:126117001-126117023 CCCTTTAGAAAGGCTTCAGGCTT No data
Right 1060743843 9:126117017-126117039 CAGGCTTAAGACTCTGCATTAGG No data
1060743837_1060743843 14 Left 1060743837 9:126116980-126117002 CCTACAGCCTGAAAGGGTTTTCC No data
Right 1060743843 9:126117017-126117039 CAGGCTTAAGACTCTGCATTAGG No data
1060743836_1060743843 17 Left 1060743836 9:126116977-126116999 CCTCCTACAGCCTGAAAGGGTTT No data
Right 1060743843 9:126117017-126117039 CAGGCTTAAGACTCTGCATTAGG No data
1060743838_1060743843 7 Left 1060743838 9:126116987-126117009 CCTGAAAGGGTTTTCCCTTTAGA No data
Right 1060743843 9:126117017-126117039 CAGGCTTAAGACTCTGCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060743843 Original CRISPR CAGGCTTAAGACTCTGCATT AGG Intergenic
No off target data available for this crispr