ID: 1060744930

View in Genome Browser
Species Human (GRCh38)
Location 9:126125075-126125097
Sequence GCTCTCGTATAGCCGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060744925_1060744930 28 Left 1060744925 9:126125024-126125046 CCCTAATCAACTGGTCAAAGTTA No data
Right 1060744930 9:126125075-126125097 GCTCTCGTATAGCCGTGCTGTGG No data
1060744926_1060744930 27 Left 1060744926 9:126125025-126125047 CCTAATCAACTGGTCAAAGTTAA No data
Right 1060744930 9:126125075-126125097 GCTCTCGTATAGCCGTGCTGTGG No data
1060744928_1060744930 -1 Left 1060744928 9:126125053-126125075 CCATCATCAGTGACGTGGTGTGG No data
Right 1060744930 9:126125075-126125097 GCTCTCGTATAGCCGTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060744930 Original CRISPR GCTCTCGTATAGCCGTGCTG TGG Intergenic
No off target data available for this crispr