ID: 1060746679

View in Genome Browser
Species Human (GRCh38)
Location 9:126139503-126139525
Sequence TCATACACACACAGAGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060746679_1060746682 21 Left 1060746679 9:126139503-126139525 CCCCTCTCTCTGTGTGTGTATGA No data
Right 1060746682 9:126139547-126139569 TATATACACACACATTCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060746679 Original CRISPR TCATACACACACAGAGAGAG GGG (reversed) Intergenic
No off target data available for this crispr