ID: 1060749539

View in Genome Browser
Species Human (GRCh38)
Location 9:126159863-126159885
Sequence CACATGTTCTGGTACTCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060749526_1060749539 17 Left 1060749526 9:126159823-126159845 CCATCCACAGCTCGGTTTCCTGG No data
Right 1060749539 9:126159863-126159885 CACATGTTCTGGTACTCACCAGG No data
1060749535_1060749539 -1 Left 1060749535 9:126159841-126159863 CCTGGGGAAAAGGGAGGGAACCC No data
Right 1060749539 9:126159863-126159885 CACATGTTCTGGTACTCACCAGG No data
1060749530_1060749539 13 Left 1060749530 9:126159827-126159849 CCACAGCTCGGTTTCCTGGGGAA No data
Right 1060749539 9:126159863-126159885 CACATGTTCTGGTACTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060749539 Original CRISPR CACATGTTCTGGTACTCACC AGG Intergenic
No off target data available for this crispr