ID: 1060751856

View in Genome Browser
Species Human (GRCh38)
Location 9:126174734-126174756
Sequence GCTGCTGGAGCCACTCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060751853_1060751856 9 Left 1060751853 9:126174702-126174724 CCTTTAAAGAAGTGTCATTACAT No data
Right 1060751856 9:126174734-126174756 GCTGCTGGAGCCACTCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060751856 Original CRISPR GCTGCTGGAGCCACTCAGCC TGG Intergenic
No off target data available for this crispr