ID: 1060753701

View in Genome Browser
Species Human (GRCh38)
Location 9:126193111-126193133
Sequence GAGGCTAGGTCTTGGGTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060753701_1060753713 10 Left 1060753701 9:126193111-126193133 CCACTTACCCAAGACCTAGCCTC No data
Right 1060753713 9:126193144-126193166 CCAGTGGAAGGTTGATATTGAGG No data
1060753701_1060753714 11 Left 1060753701 9:126193111-126193133 CCACTTACCCAAGACCTAGCCTC No data
Right 1060753714 9:126193145-126193167 CAGTGGAAGGTTGATATTGAGGG No data
1060753701_1060753705 -6 Left 1060753701 9:126193111-126193133 CCACTTACCCAAGACCTAGCCTC No data
Right 1060753705 9:126193128-126193150 AGCCTCCTTGTTTCCCCCAGTGG No data
1060753701_1060753707 -2 Left 1060753701 9:126193111-126193133 CCACTTACCCAAGACCTAGCCTC No data
Right 1060753707 9:126193132-126193154 TCCTTGTTTCCCCCAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060753701 Original CRISPR GAGGCTAGGTCTTGGGTAAG TGG (reversed) Intergenic
No off target data available for this crispr