ID: 1060754314

View in Genome Browser
Species Human (GRCh38)
Location 9:126201351-126201373
Sequence ATGACCCACTAGAAGAGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060754313_1060754314 9 Left 1060754313 9:126201319-126201341 CCTACAATAGGTTTAAAAATAAA No data
Right 1060754314 9:126201351-126201373 ATGACCCACTAGAAGAGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060754314 Original CRISPR ATGACCCACTAGAAGAGCTA AGG Intergenic
No off target data available for this crispr