ID: 1060756084

View in Genome Browser
Species Human (GRCh38)
Location 9:126214979-126215001
Sequence CTGCTCCCTGAACCCTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060756083_1060756084 -10 Left 1060756083 9:126214966-126214988 CCTCTCTTGACTGCTGCTCCCTG No data
Right 1060756084 9:126214979-126215001 CTGCTCCCTGAACCCTTTGCTGG No data
1060756082_1060756084 -3 Left 1060756082 9:126214959-126214981 CCTCGTACCTCTCTTGACTGCTG No data
Right 1060756084 9:126214979-126215001 CTGCTCCCTGAACCCTTTGCTGG No data
1060756080_1060756084 6 Left 1060756080 9:126214950-126214972 CCTGGTTTCCCTCGTACCTCTCT No data
Right 1060756084 9:126214979-126215001 CTGCTCCCTGAACCCTTTGCTGG No data
1060756081_1060756084 -2 Left 1060756081 9:126214958-126214980 CCCTCGTACCTCTCTTGACTGCT No data
Right 1060756084 9:126214979-126215001 CTGCTCCCTGAACCCTTTGCTGG No data
1060756079_1060756084 23 Left 1060756079 9:126214933-126214955 CCAGGACATGACACTCTCCTGGT No data
Right 1060756084 9:126214979-126215001 CTGCTCCCTGAACCCTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060756084 Original CRISPR CTGCTCCCTGAACCCTTTGC TGG Intergenic
No off target data available for this crispr