ID: 1060758943

View in Genome Browser
Species Human (GRCh38)
Location 9:126232824-126232846
Sequence TCCCTTGCCCTGAACTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060758943_1060758947 0 Left 1060758943 9:126232824-126232846 CCTCCCAAGTTCAGGGCAAGGGA No data
Right 1060758947 9:126232847-126232869 CCACTGTCTCCACTATCCCCTGG No data
1060758943_1060758950 9 Left 1060758943 9:126232824-126232846 CCTCCCAAGTTCAGGGCAAGGGA No data
Right 1060758950 9:126232856-126232878 CCACTATCCCCTGGGAAGAGTGG No data
1060758943_1060758948 1 Left 1060758943 9:126232824-126232846 CCTCCCAAGTTCAGGGCAAGGGA No data
Right 1060758948 9:126232848-126232870 CACTGTCTCCACTATCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060758943 Original CRISPR TCCCTTGCCCTGAACTTGGG AGG (reversed) Intergenic
No off target data available for this crispr