ID: 1060758948

View in Genome Browser
Species Human (GRCh38)
Location 9:126232848-126232870
Sequence CACTGTCTCCACTATCCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060758943_1060758948 1 Left 1060758943 9:126232824-126232846 CCTCCCAAGTTCAGGGCAAGGGA No data
Right 1060758948 9:126232848-126232870 CACTGTCTCCACTATCCCCTGGG No data
1060758945_1060758948 -3 Left 1060758945 9:126232828-126232850 CCAAGTTCAGGGCAAGGGACCAC No data
Right 1060758948 9:126232848-126232870 CACTGTCTCCACTATCCCCTGGG No data
1060758944_1060758948 -2 Left 1060758944 9:126232827-126232849 CCCAAGTTCAGGGCAAGGGACCA No data
Right 1060758948 9:126232848-126232870 CACTGTCTCCACTATCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060758948 Original CRISPR CACTGTCTCCACTATCCCCT GGG Intergenic
No off target data available for this crispr