ID: 1060760672

View in Genome Browser
Species Human (GRCh38)
Location 9:126245562-126245584
Sequence AAACTTGTGCAGTCACACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060760663_1060760672 18 Left 1060760663 9:126245521-126245543 CCAGACGCTTGGTATTCCCCAGG No data
Right 1060760672 9:126245562-126245584 AAACTTGTGCAGTCACACAGAGG No data
1060760670_1060760672 1 Left 1060760670 9:126245538-126245560 CCCAGGGCTGGCTTCATGGGCGT No data
Right 1060760672 9:126245562-126245584 AAACTTGTGCAGTCACACAGAGG No data
1060760660_1060760672 23 Left 1060760660 9:126245516-126245538 CCCCACCAGACGCTTGGTATTCC No data
Right 1060760672 9:126245562-126245584 AAACTTGTGCAGTCACACAGAGG No data
1060760669_1060760672 2 Left 1060760669 9:126245537-126245559 CCCCAGGGCTGGCTTCATGGGCG No data
Right 1060760672 9:126245562-126245584 AAACTTGTGCAGTCACACAGAGG No data
1060760662_1060760672 21 Left 1060760662 9:126245518-126245540 CCACCAGACGCTTGGTATTCCCC No data
Right 1060760672 9:126245562-126245584 AAACTTGTGCAGTCACACAGAGG No data
1060760661_1060760672 22 Left 1060760661 9:126245517-126245539 CCCACCAGACGCTTGGTATTCCC No data
Right 1060760672 9:126245562-126245584 AAACTTGTGCAGTCACACAGAGG No data
1060760671_1060760672 0 Left 1060760671 9:126245539-126245561 CCAGGGCTGGCTTCATGGGCGTG 0: 2
1: 11
2: 25
3: 75
4: 301
Right 1060760672 9:126245562-126245584 AAACTTGTGCAGTCACACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060760672 Original CRISPR AAACTTGTGCAGTCACACAG AGG Intergenic
No off target data available for this crispr