ID: 1060766272

View in Genome Browser
Species Human (GRCh38)
Location 9:126296807-126296829
Sequence AGAGAGGCTTAGAACTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060766272_1060766274 -9 Left 1060766272 9:126296807-126296829 CCACTCCAGTTCTAAGCCTCTCT No data
Right 1060766274 9:126296821-126296843 AGCCTCTCTCCTCCCACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060766272 Original CRISPR AGAGAGGCTTAGAACTGGAG TGG (reversed) Intergenic
No off target data available for this crispr