ID: 1060766614

View in Genome Browser
Species Human (GRCh38)
Location 9:126298718-126298740
Sequence CAGTAGAAACAGCTGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060766614_1060766619 24 Left 1060766614 9:126298718-126298740 CCTTGCTCCAGCTGTTTCTACTG No data
Right 1060766619 9:126298765-126298787 CCAATCCCCTAGCCTTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060766614 Original CRISPR CAGTAGAAACAGCTGGAGCA AGG (reversed) Intergenic
No off target data available for this crispr