ID: 1060766619

View in Genome Browser
Species Human (GRCh38)
Location 9:126298765-126298787
Sequence CCAATCCCCTAGCCTTTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060766615_1060766619 17 Left 1060766615 9:126298725-126298747 CCAGCTGTTTCTACTGCCTTGAA No data
Right 1060766619 9:126298765-126298787 CCAATCCCCTAGCCTTTTCTTGG No data
1060766614_1060766619 24 Left 1060766614 9:126298718-126298740 CCTTGCTCCAGCTGTTTCTACTG No data
Right 1060766619 9:126298765-126298787 CCAATCCCCTAGCCTTTTCTTGG No data
1060766616_1060766619 1 Left 1060766616 9:126298741-126298763 CCTTGAAAGCGCTCTTTCTTTCT No data
Right 1060766619 9:126298765-126298787 CCAATCCCCTAGCCTTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060766619 Original CRISPR CCAATCCCCTAGCCTTTTCT TGG Intergenic
No off target data available for this crispr