ID: 1060768403

View in Genome Browser
Species Human (GRCh38)
Location 9:126312245-126312267
Sequence CCAGCCACACTGGCCCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060768403_1060768410 -6 Left 1060768403 9:126312245-126312267 CCTTCAAGGGCCAGTGTGGCTGG No data
Right 1060768410 9:126312262-126312284 GGCTGGAACAGGGTGGATGTGGG No data
1060768403_1060768413 10 Left 1060768403 9:126312245-126312267 CCTTCAAGGGCCAGTGTGGCTGG No data
Right 1060768413 9:126312278-126312300 ATGTGGGAGCCGAGGACAGGAGG No data
1060768403_1060768416 13 Left 1060768403 9:126312245-126312267 CCTTCAAGGGCCAGTGTGGCTGG No data
Right 1060768416 9:126312281-126312303 TGGGAGCCGAGGACAGGAGGGGG No data
1060768403_1060768419 28 Left 1060768403 9:126312245-126312267 CCTTCAAGGGCCAGTGTGGCTGG No data
Right 1060768419 9:126312296-126312318 GGAGGGGGTACCTGAGAGGTAGG No data
1060768403_1060768418 24 Left 1060768403 9:126312245-126312267 CCTTCAAGGGCCAGTGTGGCTGG No data
Right 1060768418 9:126312292-126312314 GACAGGAGGGGGTACCTGAGAGG No data
1060768403_1060768409 -7 Left 1060768403 9:126312245-126312267 CCTTCAAGGGCCAGTGTGGCTGG No data
Right 1060768409 9:126312261-126312283 TGGCTGGAACAGGGTGGATGTGG No data
1060768403_1060768412 7 Left 1060768403 9:126312245-126312267 CCTTCAAGGGCCAGTGTGGCTGG No data
Right 1060768412 9:126312275-126312297 TGGATGTGGGAGCCGAGGACAGG No data
1060768403_1060768415 12 Left 1060768403 9:126312245-126312267 CCTTCAAGGGCCAGTGTGGCTGG No data
Right 1060768415 9:126312280-126312302 GTGGGAGCCGAGGACAGGAGGGG No data
1060768403_1060768411 2 Left 1060768403 9:126312245-126312267 CCTTCAAGGGCCAGTGTGGCTGG No data
Right 1060768411 9:126312270-126312292 CAGGGTGGATGTGGGAGCCGAGG No data
1060768403_1060768414 11 Left 1060768403 9:126312245-126312267 CCTTCAAGGGCCAGTGTGGCTGG No data
Right 1060768414 9:126312279-126312301 TGTGGGAGCCGAGGACAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060768403 Original CRISPR CCAGCCACACTGGCCCTTGA AGG (reversed) Intergenic