ID: 1060770078

View in Genome Browser
Species Human (GRCh38)
Location 9:126326535-126326557
Sequence AGGCCCGGGTGGGCGCACCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060770071_1060770078 -8 Left 1060770071 9:126326520-126326542 CCGGCGGGCTCGGGGAGGCCCGG No data
Right 1060770078 9:126326535-126326557 AGGCCCGGGTGGGCGCACCGGGG No data
1060770063_1060770078 13 Left 1060770063 9:126326499-126326521 CCTGAGGCTGGACTGGGGTCGCC No data
Right 1060770078 9:126326535-126326557 AGGCCCGGGTGGGCGCACCGGGG No data
1060770059_1060770078 20 Left 1060770059 9:126326492-126326514 CCGGGGGCCTGAGGCTGGACTGG No data
Right 1060770078 9:126326535-126326557 AGGCCCGGGTGGGCGCACCGGGG No data
1060770058_1060770078 21 Left 1060770058 9:126326491-126326513 CCCGGGGGCCTGAGGCTGGACTG No data
Right 1060770078 9:126326535-126326557 AGGCCCGGGTGGGCGCACCGGGG No data
1060770055_1060770078 30 Left 1060770055 9:126326482-126326504 CCGTGGGCTCCCGGGGGCCTGAG No data
Right 1060770078 9:126326535-126326557 AGGCCCGGGTGGGCGCACCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060770078 Original CRISPR AGGCCCGGGTGGGCGCACCG GGG Intergenic
No off target data available for this crispr