ID: 1060770475

View in Genome Browser
Species Human (GRCh38)
Location 9:126327974-126327996
Sequence ACAATGAGATTATACTGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 183}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060770475_1060770478 20 Left 1060770475 9:126327974-126327996 CCTTCTCAGTATAATCTCATTGT 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1060770478 9:126328017-126328039 GGATCTCATCTCGTTTTAACAGG No data
1060770475_1060770479 21 Left 1060770475 9:126327974-126327996 CCTTCTCAGTATAATCTCATTGT 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1060770479 9:126328018-126328040 GATCTCATCTCGTTTTAACAGGG No data
1060770475_1060770476 -5 Left 1060770475 9:126327974-126327996 CCTTCTCAGTATAATCTCATTGT 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1060770476 9:126327992-126328014 ATTGTACATTTCTCGACAGCTGG No data
1060770475_1060770480 25 Left 1060770475 9:126327974-126327996 CCTTCTCAGTATAATCTCATTGT 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1060770480 9:126328022-126328044 TCATCTCGTTTTAACAGGGCTGG No data
1060770475_1060770477 -1 Left 1060770475 9:126327974-126327996 CCTTCTCAGTATAATCTCATTGT 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1060770477 9:126327996-126328018 TACATTTCTCGACAGCTGGCTGG No data
1060770475_1060770481 26 Left 1060770475 9:126327974-126327996 CCTTCTCAGTATAATCTCATTGT 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1060770481 9:126328023-126328045 CATCTCGTTTTAACAGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060770475 Original CRISPR ACAATGAGATTATACTGAGA AGG (reversed) Intronic
900770132 1:4534533-4534555 TCCATGAGGTTATACTGATATGG + Intergenic
901910227 1:12451243-12451265 ACAATGAGATTATTTTGGGAAGG + Intronic
902915917 1:19639341-19639363 AAGGTGAGATTATAATGAGATGG - Intronic
904450427 1:30607427-30607449 ACTATGAGGTTTTAATGAGATGG - Intergenic
904798876 1:33078946-33078968 CCTAAAAGATTATACTGAGAGGG - Intronic
907534925 1:55143261-55143283 AAAATAATATTATACTGATATGG + Intronic
907875392 1:58482141-58482163 ACAATTTCATCATACTGAGAAGG + Intronic
908779695 1:67678903-67678925 ACAAAGAGATTATAATGATGAGG - Intergenic
909123274 1:71632192-71632214 AGAAAGAGATTATACTGATATGG - Intronic
909933659 1:81527328-81527350 CCAATGAGATAATATTAAGAGGG + Intronic
910031097 1:82724705-82724727 ACACTGGGAACATACTGAGATGG - Intergenic
910133832 1:83942626-83942648 ACAATCAAATGATCCTGAGATGG + Exonic
910201792 1:84707639-84707661 AAAAGGAGATTATCCTGAGTGGG + Intergenic
912625084 1:111199816-111199838 TCAATGAGATTATACTAAATGGG - Intronic
916810736 1:168303482-168303504 ACAAAAAGATGTTACTGAGAAGG + Intronic
918924863 1:190770091-190770113 AGAATGAGAATATAAAGAGAAGG + Intergenic
923747259 1:236713169-236713191 ACAAAGAATTTATACTGATATGG + Intronic
924219727 1:241861338-241861360 CAAATGATATTATACTAAGATGG - Intronic
1065195337 10:23258710-23258732 ACAATGAGATCATTCGGACATGG + Intergenic
1065198517 10:23290332-23290354 AGAATGAGACTATACTGGCATGG + Intronic
1065526582 10:26627902-26627924 GCAATTAGCTTATCCTGAGAGGG + Intergenic
1065559847 10:26951856-26951878 GCAATTAGCTTATCCTGAGAGGG - Intergenic
1066170870 10:32843574-32843596 GCAATGAGAGGATACTGTGAGGG + Intronic
1066473049 10:35717885-35717907 ACAAAGATATTATAAAGAGATGG + Intergenic
1066504889 10:36031235-36031257 ACAATGACATTAGACTGTGAAGG + Intergenic
1068467986 10:57420134-57420156 GCAAAGAAAGTATACTGAGATGG + Intergenic
1069017005 10:63441575-63441597 AAAATGAGATAATTTTGAGAAGG - Intronic
1070481153 10:76884072-76884094 CCAATGAGATGATATTGTGATGG - Intronic
1071234145 10:83624829-83624851 AAGATGAGATTATACTGGGGTGG + Intergenic
1072277336 10:93836037-93836059 TCAATGAGCTTTTACAGAGAAGG - Intergenic
1072469236 10:95696854-95696876 GCAAGGAGATTGTACTGAGATGG + Intergenic
1072851231 10:98894632-98894654 ACAATGAGGTTAGACTGAAAAGG + Intronic
1077842565 11:5991414-5991436 ACAAGGAGATTAAAGAGAGAGGG + Intergenic
1079347641 11:19667064-19667086 ACAATGGGAACATACAGAGAGGG - Intronic
1081286011 11:41271012-41271034 AGAATAAGATTATTCTAAGATGG - Intronic
1082918464 11:58465380-58465402 TGAAGGAGATTATACTGACATGG + Intergenic
1086614185 11:88795119-88795141 AACATGAGACTATATTGAGAGGG + Intronic
1087775497 11:102253120-102253142 ACCATGAGATCACACAGAGAAGG - Intergenic
1089852495 11:121512456-121512478 TCAATGAGATTATTCAGAGATGG + Intronic
1093166510 12:15810042-15810064 AGAATGAGAGTAAACAGAGATGG + Intronic
1093612177 12:21174442-21174464 ACAATGTGATTTAATTGAGAAGG - Intronic
1099304009 12:80932994-80933016 ACAAAGAGAAGATACTGATAAGG - Intronic
1100553047 12:95664854-95664876 ACAATGAGTTTATATGGGGAAGG + Intronic
1101706275 12:107224019-107224041 ACAAGGAGCTTATAAGGAGATGG + Intergenic
1101706392 12:107224917-107224939 ACAAGGAGCTTATAAGGAGATGG - Intergenic
1104642432 12:130476033-130476055 ACAGTGAGTATAGACTGAGAAGG + Intronic
1106870826 13:34017956-34017978 ACAATTATATTACACTGAAACGG - Intergenic
1107560559 13:41553556-41553578 ACGATGAGAATAGACTGTGACGG - Intergenic
1111732504 13:92095057-92095079 AAAATGAGATTTTTCTGAGTTGG + Intronic
1115160284 14:30386316-30386338 ACTATGTGATTAAACTGACATGG + Intergenic
1115819944 14:37203395-37203417 ACTATGTGACTAAACTGAGAAGG - Intronic
1115948095 14:38686733-38686755 AAAATGAAATTACACTGAAAGGG + Intergenic
1116224418 14:42130811-42130833 ACAGTGAGCTTGTACTCAGAGGG - Intergenic
1116452237 14:45079919-45079941 AGAATGAAGTTATATTGAGAGGG + Intergenic
1118694828 14:68374371-68374393 ATAATGAGAAGATTCTGAGAAGG + Intronic
1120211989 14:81642280-81642302 ACACAGAGAGTATACTGAAATGG - Intergenic
1120720028 14:87880758-87880780 ACAATGGCTTTAGACTGAGATGG + Intronic
1122457885 14:101869279-101869301 ATAATGAGACAACACTGAGAAGG - Intronic
1122925722 14:104898725-104898747 ACAATAAAATTTTACTGAGAAGG + Intergenic
1123818934 15:24006855-24006877 ACCATGATTTTATGCTGAGAAGG + Intergenic
1124018804 15:25901713-25901735 AAAAGGAGATTATCCTGAGTGGG + Intergenic
1125237274 15:37530008-37530030 ACAATGTGATGATAAGGAGAAGG + Intergenic
1125312569 15:38396485-38396507 AAAATCAGAATATACGGAGAAGG - Intergenic
1127100908 15:55563859-55563881 GCAATGAGATAACACTGGGATGG + Intronic
1128503097 15:68243282-68243304 ACACTGAAATCATACTGATATGG + Intronic
1135790773 16:25392635-25392657 TAAATGAGATTATAGGGAGAGGG + Intergenic
1137888832 16:52136496-52136518 TCAATGAGATAATACAGATAAGG + Intergenic
1143806466 17:9431950-9431972 ACAAGGAGATTGAAGTGAGAGGG - Intronic
1148041048 17:44707645-44707667 ACAGTAACATTTTACTGAGAGGG + Intergenic
1148588870 17:48800638-48800660 ACCATCAGATTATACTCACATGG - Intronic
1150747778 17:67830098-67830120 ACATTGCCAATATACTGAGAAGG + Intronic
1154079430 18:11241523-11241545 ACAAAGAGATTCTACAGACAGGG + Intergenic
1156148868 18:34221112-34221134 ACAATGAGTTTATACTCATATGG - Intronic
1156787329 18:40931491-40931513 ACAATGAGCTTGTATTGAGTGGG + Intergenic
1158319306 18:56245851-56245873 AAAATCAGATAACACTGAGAAGG - Intergenic
1159753765 18:72337154-72337176 ATAATGAAGTTATATTGAGATGG + Intergenic
1166158631 19:40935069-40935091 ACAATCACATTATACAGGGAGGG + Intergenic
926359769 2:12075496-12075518 AAAATGTGATTATTCTGAGGTGG - Intergenic
926461334 2:13133142-13133164 ACAATGAGTTGATATTGAAATGG + Intergenic
928908795 2:36397321-36397343 ACAAGAAAATTATACTGATATGG + Intronic
929927407 2:46226270-46226292 ATAATATAATTATACTGAGAGGG + Intergenic
930325157 2:49907039-49907061 ACAATGGCATTATAATGATAAGG - Intergenic
931103869 2:59032805-59032827 AAAGTGAGCTAATACTGAGAAGG - Intergenic
932546998 2:72722994-72723016 AAAATGTGACTATACTGGGAAGG - Intronic
934047644 2:88185843-88185865 ACAATGAGAGAATAGAGAGATGG - Intronic
934581909 2:95449203-95449225 AGAATGAAGGTATACTGAGAAGG + Intergenic
934597541 2:95627511-95627533 AGAATGAAGGTATACTGAGAAGG - Intergenic
934885905 2:98024183-98024205 ACAATAAGAGGATAATGAGAAGG - Intergenic
938395672 2:130946009-130946031 ACAATGGGATGATACAGAAAAGG + Intronic
939591549 2:144070086-144070108 AAAATTAGATTAGATTGAGAGGG - Intronic
940104461 2:150082604-150082626 ACAATGAGATTCTAATGTGCAGG + Intergenic
940523736 2:154784972-154784994 AAAGTGAGATTATATTGTGATGG + Intronic
940590802 2:155723504-155723526 ACAATAGTATTATATTGAGAGGG - Intergenic
942078840 2:172381760-172381782 ACAATGGGATTGAAATGAGAGGG + Intergenic
942707122 2:178787224-178787246 TAAATGAGATTTTTCTGAGATGG + Intronic
943525815 2:189015975-189015997 ACCTTGAGAATATACTCAGAAGG - Intergenic
948409512 2:237748378-237748400 AGAAAAAGATTTTACTGAGAAGG + Exonic
1170871558 20:20211049-20211071 ACATTCAAATTAAACTGAGATGG + Intronic
1178459418 21:32788778-32788800 ACAATGAGTTTAGAATGTGAAGG - Intergenic
1180336701 22:11583114-11583136 AAAAGGACATTATACAGAGAGGG - Intergenic
949478513 3:4471461-4471483 ACAAAGAGATTTTACTCTGAAGG - Intergenic
949971766 3:9413226-9413248 ATAATGAGTTTATACTAAGAGGG + Intronic
957591907 3:82210207-82210229 AAAATGAGATTAAGTTGAGAAGG + Intergenic
957891708 3:86367318-86367340 ACAATGAGAATATTCTTTGAAGG + Intergenic
958930448 3:100202228-100202250 AGAATGATATTATATTGAGAAGG - Intergenic
959297234 3:104552225-104552247 TCAATGAGATTTTTCTGAAAAGG + Intergenic
959669447 3:108959397-108959419 AGGATGAGATTAGACTGAGGAGG - Intronic
959669504 3:108959999-108960021 AGGATGAGATTAGACTGAGGGGG + Intronic
961855180 3:129863471-129863493 ATCCTGAGATTCTACTGAGAAGG + Intronic
964677500 3:159300069-159300091 ATATTGAGATTAAATTGAGAGGG - Intronic
965630488 3:170727607-170727629 ACAAGGAAAAGATACTGAGATGG - Intronic
965840013 3:172893793-172893815 ACAAGTAAATTATACTGAGAAGG + Intronic
965871272 3:173268063-173268085 ATAATGAGATTATAGGGAGGAGG + Intergenic
966105911 3:176333524-176333546 ACAAAAAGAGTATACTGAGTGGG + Intergenic
969226562 4:5802333-5802355 ACAAGGATAGGATACTGAGATGG + Intronic
970445862 4:16122875-16122897 TCAATGACATTATAATGAGCTGG + Intergenic
970923190 4:21418918-21418940 AGAATGAGATTATTCAGGGATGG + Intronic
971063192 4:22995836-22995858 AAAATAAAATTATACTGACAAGG - Intergenic
972087039 4:35230744-35230766 ACAATGGGATGATCCAGAGAAGG + Intergenic
972816236 4:42649483-42649505 ACAATGTGATTATATTTGGATGG + Intronic
973184757 4:47312693-47312715 ACAATTATGTTATACAGAGATGG + Intronic
974179633 4:58367073-58367095 ACTTTGAGAATAAACTGAGAGGG + Intergenic
975600430 4:76094073-76094095 ATAATGAGGATATAGTGAGAAGG + Intronic
978172521 4:105690256-105690278 ATAATGAGATTATACTCATTAGG - Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979410109 4:120367133-120367155 ACCATGAGGTAAGACTGAGAAGG - Intergenic
981477789 4:145205787-145205809 ATAAAGAGATTAAACTTAGAAGG + Intergenic
981617187 4:146654572-146654594 AAAATGAGATTATTCTTTGAGGG - Intergenic
981800486 4:148649394-148649416 TAAATGAGATTATCTTGAGATGG + Intergenic
982245964 4:153350992-153351014 ACAATAAGATTATACTTAGTGGG - Intronic
983417863 4:167481168-167481190 AGAATGAAATGATACTTAGAAGG + Intergenic
984207092 4:176798385-176798407 ATAATGAGCTTATACTGATTTGG - Intergenic
986603146 5:9494372-9494394 GCAAAGAGATTATATTCAGAAGG - Intronic
987419888 5:17707193-17707215 ACTATGAAATTAATCTGAGAGGG + Intergenic
989176816 5:38535790-38535812 ACAATGAAAGTATACTGTGTGGG - Intronic
991308069 5:65202518-65202540 TCAATGAGATTACACTAAAATGG + Intronic
993341946 5:86735654-86735676 ACAATGAGAATACACAGACACGG + Intergenic
993892888 5:93495155-93495177 ATAATGACATTATACTTACATGG + Intergenic
994169003 5:96638879-96638901 AGAAGGAGATGAAACTGAGAAGG - Intronic
994973929 5:106778193-106778215 ACAATGAGTTTATTCTAACAAGG - Intergenic
998675483 5:144403311-144403333 AAAATGAGATTATACTGAATGGG + Intronic
1000040769 5:157483575-157483597 CCAAAGAGATTACACTGGGATGG + Intronic
1000662863 5:163957411-163957433 ACACTGAGGATATAATGAGAAGG - Intergenic
1000684891 5:164236218-164236240 ACAATGTGATGATATTGAGGTGG + Intergenic
1001046119 5:168373216-168373238 ACCATGAGATTTTAATGAGGGGG - Intronic
1002825283 6:767179-767201 ATAGTGAGAATATACTGAGAGGG + Intergenic
1005246329 6:23889742-23889764 ACAATGACATTCTAGGGAGATGG - Intergenic
1007394866 6:41571752-41571774 AAAATGAAATTACACAGAGAGGG - Intronic
1008060804 6:46994704-46994726 ACAATGTAACTATATTGAGAAGG - Intergenic
1008696801 6:54048068-54048090 ACCATGAGAGTGTCCTGAGAAGG + Intronic
1009033047 6:58083236-58083258 ACCATGCAATAATACTGAGAGGG + Intergenic
1009335735 6:62488772-62488794 ATAATAAAACTATACTGAGATGG - Intergenic
1009732899 6:67633657-67633679 ACAATGAAATTAGGCTGAGGTGG + Intergenic
1010401033 6:75446400-75446422 AGAGGGAGATTTTACTGAGATGG - Intronic
1010753990 6:79645633-79645655 ACCATAAGATTATATCGAGAAGG + Intronic
1012356181 6:98317152-98317174 AAAAGGAGATTATCCTGAGTCGG + Intergenic
1014327685 6:120019046-120019068 ACAATGAAATCAGGCTGAGATGG - Intergenic
1014452566 6:121598058-121598080 GAAATGAGATTATCCTTAGATGG + Intergenic
1017741578 6:157411275-157411297 ACAGTGACATCATACAGAGATGG + Intronic
1017776579 6:157685673-157685695 CCGATGAGATAATACAGAGATGG - Intergenic
1020680694 7:11233172-11233194 ACAATGAGATCATACAGGAAAGG - Intergenic
1020960502 7:14796975-14796997 GCAAAGAGACTATACTGACATGG + Intronic
1021036007 7:15799875-15799897 AGAATAAGAGTAGACTGAGAGGG - Intergenic
1021278354 7:18684492-18684514 ACAATAAAACTATACTGAAAAGG + Intronic
1021895745 7:25233713-25233735 ACAACTAGGTTATACTTAGATGG - Intergenic
1022747189 7:33184443-33184465 ACCAAGAGATTTTACTGAGAGGG + Intronic
1030149093 7:106385014-106385036 ACTATGAGACTGTACTGTGAGGG - Intergenic
1030728961 7:112961703-112961725 ATAATATGATAATACTGAGATGG + Intergenic
1031565455 7:123291530-123291552 ACAAAGACATTAAACTAAGAGGG + Intergenic
1039974138 8:42345779-42345801 TCACTGAGAATATCCTGAGATGG + Intronic
1043202376 8:77386342-77386364 ACAATCAGCTTAAACTGGGAGGG - Intergenic
1045070057 8:98493620-98493642 AGAATAATATTAGACTGAGATGG - Intronic
1045462397 8:102437048-102437070 ACCCTCAGATTTTACTGAGATGG - Intergenic
1046274925 8:111946209-111946231 GCATTGAGAATATAGTGAGACGG + Intergenic
1048337436 8:133513535-133513557 ACAAACAGATGGTACTGAGATGG + Intronic
1048489959 8:134883583-134883605 ACAATGAGACTCAGCTGAGAGGG - Intergenic
1049515650 8:143053577-143053599 ACAAAGGGATTTTACTGAGTGGG + Exonic
1050940133 9:11448274-11448296 ACAAGGAAATTATAATGATAAGG + Intergenic
1050963915 9:11772143-11772165 ACAATGAGAATATATGGACATGG + Intergenic
1051606578 9:18923105-18923127 GCAATGAGACTATAATGAAAAGG + Intergenic
1051985633 9:23083554-23083576 ACAATGAAATTTTCCTGATATGG + Intergenic
1052727930 9:32252223-32252245 ACAATGAAATTATACATATAAGG + Intergenic
1056806942 9:89736344-89736366 AAAAGGAGATTATTCTGGGAGGG - Intergenic
1057808596 9:98240223-98240245 ATAATGAGATTATACTTTCATGG + Intronic
1060770475 9:126327974-126327996 ACAATGAGATTATACTGAGAAGG - Intronic
1062125954 9:134863056-134863078 AAAATTAGTTTATACTCAGAAGG - Intergenic
1186241497 X:7572254-7572276 AAAATGAGATAAAAATGAGAAGG + Intergenic
1188318368 X:28704879-28704901 AGAATGAGACAATACTGGGATGG + Intronic
1190259179 X:48787252-48787274 ACAAAGATATTTTACTGAGCAGG - Intronic
1192236105 X:69297166-69297188 ACAATGAGATGCTAGTGAAAGGG + Intergenic
1192914906 X:75641529-75641551 ACAATGAGAACACACTGAAATGG - Intergenic
1193322369 X:80138003-80138025 AATGTTAGATTATACTGAGATGG - Intergenic
1195595266 X:106681939-106681961 ACAATGAGTTTAAAATGAAATGG + Intergenic
1195837872 X:109139457-109139479 ACAATGAGAATACACAGACACGG + Intergenic
1196657249 X:118231501-118231523 ACAAACAGATTGTACAGAGATGG + Intergenic
1196683414 X:118491368-118491390 AGAATGATCATATACTGAGATGG + Intergenic
1198661701 X:138975884-138975906 GCAATGTGAATATACTGGGAAGG + Intronic
1198944867 X:141999723-141999745 AGAATGAGATTCTACTGAAGGGG - Intergenic
1199002664 X:142657767-142657789 ACAATGATAATATAATGAGATGG + Intergenic
1199433949 X:147791983-147792005 ATAAATAGATTATACTGAGCTGG - Intergenic