ID: 1060771058

View in Genome Browser
Species Human (GRCh38)
Location 9:126332578-126332600
Sequence GACACACACCATGACCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060771058_1060771064 10 Left 1060771058 9:126332578-126332600 CCCCTGGGGTCATGGTGTGTGTC No data
Right 1060771064 9:126332611-126332633 GAATCAGTGACCCCAGACCCCGG No data
1060771058_1060771065 11 Left 1060771058 9:126332578-126332600 CCCCTGGGGTCATGGTGTGTGTC No data
Right 1060771065 9:126332612-126332634 AATCAGTGACCCCAGACCCCGGG No data
1060771058_1060771073 27 Left 1060771058 9:126332578-126332600 CCCCTGGGGTCATGGTGTGTGTC No data
Right 1060771073 9:126332628-126332650 CCCCGGGCTTTCACTGGAAGGGG No data
1060771058_1060771068 21 Left 1060771058 9:126332578-126332600 CCCCTGGGGTCATGGTGTGTGTC No data
Right 1060771068 9:126332622-126332644 CCCAGACCCCGGGCTTTCACTGG No data
1060771058_1060771071 26 Left 1060771058 9:126332578-126332600 CCCCTGGGGTCATGGTGTGTGTC No data
Right 1060771071 9:126332627-126332649 ACCCCGGGCTTTCACTGGAAGGG No data
1060771058_1060771070 25 Left 1060771058 9:126332578-126332600 CCCCTGGGGTCATGGTGTGTGTC No data
Right 1060771070 9:126332626-126332648 GACCCCGGGCTTTCACTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060771058 Original CRISPR GACACACACCATGACCCCAG GGG (reversed) Intronic