ID: 1060771059

View in Genome Browser
Species Human (GRCh38)
Location 9:126332579-126332601
Sequence GGACACACACCATGACCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060771059_1060771065 10 Left 1060771059 9:126332579-126332601 CCCTGGGGTCATGGTGTGTGTCC No data
Right 1060771065 9:126332612-126332634 AATCAGTGACCCCAGACCCCGGG No data
1060771059_1060771073 26 Left 1060771059 9:126332579-126332601 CCCTGGGGTCATGGTGTGTGTCC No data
Right 1060771073 9:126332628-126332650 CCCCGGGCTTTCACTGGAAGGGG No data
1060771059_1060771068 20 Left 1060771059 9:126332579-126332601 CCCTGGGGTCATGGTGTGTGTCC No data
Right 1060771068 9:126332622-126332644 CCCAGACCCCGGGCTTTCACTGG No data
1060771059_1060771070 24 Left 1060771059 9:126332579-126332601 CCCTGGGGTCATGGTGTGTGTCC No data
Right 1060771070 9:126332626-126332648 GACCCCGGGCTTTCACTGGAAGG No data
1060771059_1060771064 9 Left 1060771059 9:126332579-126332601 CCCTGGGGTCATGGTGTGTGTCC No data
Right 1060771064 9:126332611-126332633 GAATCAGTGACCCCAGACCCCGG No data
1060771059_1060771071 25 Left 1060771059 9:126332579-126332601 CCCTGGGGTCATGGTGTGTGTCC No data
Right 1060771071 9:126332627-126332649 ACCCCGGGCTTTCACTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060771059 Original CRISPR GGACACACACCATGACCCCA GGG (reversed) Intronic