ID: 1060771063

View in Genome Browser
Species Human (GRCh38)
Location 9:126332600-126332622
Sequence GGTCACTGATTCCTCCATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060771063_1060771073 5 Left 1060771063 9:126332600-126332622 CCTGTATGGAGGAATCAGTGACC No data
Right 1060771073 9:126332628-126332650 CCCCGGGCTTTCACTGGAAGGGG No data
1060771063_1060771071 4 Left 1060771063 9:126332600-126332622 CCTGTATGGAGGAATCAGTGACC No data
Right 1060771071 9:126332627-126332649 ACCCCGGGCTTTCACTGGAAGGG No data
1060771063_1060771068 -1 Left 1060771063 9:126332600-126332622 CCTGTATGGAGGAATCAGTGACC No data
Right 1060771068 9:126332622-126332644 CCCAGACCCCGGGCTTTCACTGG No data
1060771063_1060771070 3 Left 1060771063 9:126332600-126332622 CCTGTATGGAGGAATCAGTGACC No data
Right 1060771070 9:126332626-126332648 GACCCCGGGCTTTCACTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060771063 Original CRISPR GGTCACTGATTCCTCCATAC AGG (reversed) Intronic