ID: 1060771063 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:126332600-126332622 |
Sequence | GGTCACTGATTCCTCCATAC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1060771063_1060771073 | 5 | Left | 1060771063 | 9:126332600-126332622 | CCTGTATGGAGGAATCAGTGACC | No data | ||
Right | 1060771073 | 9:126332628-126332650 | CCCCGGGCTTTCACTGGAAGGGG | No data | ||||
1060771063_1060771071 | 4 | Left | 1060771063 | 9:126332600-126332622 | CCTGTATGGAGGAATCAGTGACC | No data | ||
Right | 1060771071 | 9:126332627-126332649 | ACCCCGGGCTTTCACTGGAAGGG | No data | ||||
1060771063_1060771068 | -1 | Left | 1060771063 | 9:126332600-126332622 | CCTGTATGGAGGAATCAGTGACC | No data | ||
Right | 1060771068 | 9:126332622-126332644 | CCCAGACCCCGGGCTTTCACTGG | No data | ||||
1060771063_1060771070 | 3 | Left | 1060771063 | 9:126332600-126332622 | CCTGTATGGAGGAATCAGTGACC | No data | ||
Right | 1060771070 | 9:126332626-126332648 | GACCCCGGGCTTTCACTGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1060771063 | Original CRISPR | GGTCACTGATTCCTCCATAC AGG (reversed) | Intronic | ||