ID: 1060771068

View in Genome Browser
Species Human (GRCh38)
Location 9:126332622-126332644
Sequence CCCAGACCCCGGGCTTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060771063_1060771068 -1 Left 1060771063 9:126332600-126332622 CCTGTATGGAGGAATCAGTGACC 0: 1
1: 0
2: 0
3: 12
4: 96
Right 1060771068 9:126332622-126332644 CCCAGACCCCGGGCTTTCACTGG No data
1060771058_1060771068 21 Left 1060771058 9:126332578-126332600 CCCCTGGGGTCATGGTGTGTGTC 0: 1
1: 0
2: 3
3: 20
4: 185
Right 1060771068 9:126332622-126332644 CCCAGACCCCGGGCTTTCACTGG No data
1060771060_1060771068 19 Left 1060771060 9:126332580-126332602 CCTGGGGTCATGGTGTGTGTCCT 0: 1
1: 0
2: 4
3: 14
4: 222
Right 1060771068 9:126332622-126332644 CCCAGACCCCGGGCTTTCACTGG No data
1060771059_1060771068 20 Left 1060771059 9:126332579-126332601 CCCTGGGGTCATGGTGTGTGTCC 0: 1
1: 0
2: 3
3: 21
4: 192
Right 1060771068 9:126332622-126332644 CCCAGACCCCGGGCTTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060771068 Original CRISPR CCCAGACCCCGGGCTTTCAC TGG Intronic
No off target data available for this crispr