ID: 1060771941

View in Genome Browser
Species Human (GRCh38)
Location 9:126338182-126338204
Sequence CTGGGGGGAAGGAGGGAGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060771923_1060771941 25 Left 1060771923 9:126338134-126338156 CCATTTGTCCATATTTCACAAAG 0: 1
1: 0
2: 1
3: 25
4: 342
Right 1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG No data
1060771925_1060771941 17 Left 1060771925 9:126338142-126338164 CCATATTTCACAAAGGCCGCCTC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG No data
1060771929_1060771941 1 Left 1060771929 9:126338158-126338180 CCGCCTCCGTCCGGGGCACAGCA 0: 1
1: 0
2: 2
3: 15
4: 155
Right 1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG No data
1060771930_1060771941 -2 Left 1060771930 9:126338161-126338183 CCTCCGTCCGGGGCACAGCAGCT 0: 1
1: 0
2: 1
3: 8
4: 151
Right 1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG No data
1060771932_1060771941 -5 Left 1060771932 9:126338164-126338186 CCGTCCGGGGCACAGCAGCTGGG 0: 1
1: 0
2: 0
3: 26
4: 256
Right 1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG No data
1060771937_1060771941 -9 Left 1060771937 9:126338168-126338190 CCGGGGCACAGCAGCTGGGGGGA 0: 1
1: 0
2: 2
3: 46
4: 496
Right 1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060771941 Original CRISPR CTGGGGGGAAGGAGGGAGAA CGG Intronic
No off target data available for this crispr