ID: 1060775261

View in Genome Browser
Species Human (GRCh38)
Location 9:126368386-126368408
Sequence CAGGCTCCAAAGCCCCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 264}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060775261 Original CRISPR CAGGCTCCAAAGCCCCTTCC TGG (reversed) Intronic
900289059 1:1916137-1916159 CAGGCTCCAGGGCCGCTGCCTGG + Intronic
900957989 1:5899529-5899551 CCTGTTCCAGAGCCCCTTCCGGG + Intronic
901644457 1:10709122-10709144 GAGGCTCCAAAGCCAAGTCCTGG - Intronic
902170242 1:14604398-14604420 CACCCTCCAAATCCCCTGCCAGG + Intronic
902622291 1:17657481-17657503 CAGGCTCCTCTGCCCCTTCCAGG - Intronic
902719524 1:18294861-18294883 CAGGCTGCAGAGCCCCATCAGGG + Intronic
903453342 1:23470192-23470214 CGAGCTCTAAATCCCCTTCCAGG + Intronic
903862286 1:26371992-26372014 CAGGCTAAAAAGCCACTTTCTGG - Intronic
904197117 1:28794247-28794269 CAGGCCCCAAAGCGCTTTCTTGG - Intergenic
904762691 1:32817276-32817298 CCGGCACCAGAGCCCCTTCCTGG + Exonic
904956485 1:34288446-34288468 CAGGCTCCACAGCCCCTCATTGG + Intergenic
905524409 1:38625422-38625444 CAGCCTCCAAATCCACTCCCTGG + Intergenic
906508923 1:46400265-46400287 CAGGCTCCAGAGCATATTCCAGG - Intronic
907883635 1:58574093-58574115 CAGGCTCCAAACTTCCTTCCAGG - Intergenic
909262411 1:73508949-73508971 AAAGCTGCAAAGCCCGTTCCAGG + Intergenic
912690618 1:111801947-111801969 CTGGCTCCAAAGCCTGTGCCTGG - Intronic
915981069 1:160420232-160420254 CAGGCTCCCAAGCCTTTCCCAGG - Intronic
916521196 1:165564833-165564855 CAGGCCCCAAGACCCATTCCAGG + Intergenic
920052421 1:203171951-203171973 CAACCTGCAAATCCCCTTCCAGG - Exonic
920284755 1:204871364-204871386 AAGGCTCCAAAGCCCCTGTGTGG + Intronic
922223154 1:223624149-223624171 CAGGCTCTCAAGCGCCTGCCCGG + Intronic
922818209 1:228466288-228466310 CAGGCTCCAGAACCTCCTCCTGG + Intergenic
1065996619 10:31065305-31065327 CAGGCTCCAGAGCCACGTGCTGG + Intergenic
1066193539 10:33077473-33077495 CATGCTTCAAATCCCTTTCCAGG - Intergenic
1066204526 10:33174857-33174879 AAGACTCAGAAGCCCCTTCCAGG + Intergenic
1066629365 10:37443901-37443923 AGGGCTCCAGAGCCCCTTCAGGG - Intergenic
1067319676 10:45205800-45205822 CCGGCTCCTCAGCCCCATCCTGG - Intergenic
1068083323 10:52346712-52346734 CAGGCCCCAAAGCCCGCCCCTGG + Intergenic
1069981052 10:72252866-72252888 CAGGCCCCAAACCCCGGTCCTGG + Intergenic
1070128883 10:73643014-73643036 CAGGCTTGAAAGCCCCTTTGGGG + Intergenic
1070930232 10:80255878-80255900 CAGGCTCCACAGCCACTGCTGGG - Intergenic
1070950796 10:80429503-80429525 CAAACTCCAGAGACCCTTCCCGG + Intronic
1071386389 10:85125466-85125488 CTGGCTCCAAAGCCACATTCTGG - Intergenic
1072489351 10:95888330-95888352 CAGGCTTCCATGCCCTTTCCAGG - Intronic
1072738023 10:97892121-97892143 GAGGCTCAAGAGCCCCTTCTGGG - Intronic
1072765177 10:98089116-98089138 ATGGCTACAAAGGCCCTTCCTGG - Intergenic
1073120524 10:101119897-101119919 CAGGCTCCCCAGCCCCTCCCTGG + Intronic
1074685050 10:115954159-115954181 CAGGCTGCAATGCCTCTTCAAGG - Intergenic
1075553073 10:123408127-123408149 CAGGCTTCAGAGCCCCTGCTAGG - Intergenic
1075622275 10:123936779-123936801 CGGGCCCCACTGCCCCTTCCAGG + Intronic
1076143177 10:128095867-128095889 CAGTCACCAAACCCCCATCCTGG - Intergenic
1076199504 10:128547076-128547098 CAGGCTCCAAATGCACTTCTTGG - Intergenic
1076561838 10:131371968-131371990 CAGCCTCCAAATCCCATTTCAGG - Intergenic
1077037012 11:500119-500141 CAGACCCCAGAGCCCCGTCCAGG - Intronic
1077423960 11:2465847-2465869 CAGGCTCCAAATGGCCTTCCAGG - Intronic
1077536988 11:3129208-3129230 GTGGCTCTGAAGCCCCTTCCGGG - Intronic
1077578672 11:3403135-3403157 CAGGCTGAAATGCCCCCTCCAGG + Intergenic
1078022073 11:7664669-7664691 CTGGCTCCCAAGGCCCTTCTTGG - Intergenic
1081744686 11:45464558-45464580 CAGACTCCAGAGCCCATGCCTGG - Intergenic
1083968116 11:66055355-66055377 AAGGCTCCACTGCCCCTTCAGGG - Intronic
1084450269 11:69232767-69232789 TAGCCTCCAAAGCCCCCTCCTGG + Intergenic
1084473939 11:69378230-69378252 CAGGCTCCTGCTCCCCTTCCAGG + Intergenic
1084678688 11:70652216-70652238 CAGCCTCCAAAGTCCCTGGCAGG - Intronic
1085475402 11:76785679-76785701 CAGGCTCAAATCCCCCTTCTCGG - Intronic
1087709394 11:101531843-101531865 GAGGTTCAAAAGCCCATTCCTGG + Intronic
1088604536 11:111515066-111515088 CAGGTACCAGAGCCCTTTCCAGG + Intronic
1089446529 11:118557178-118557200 AAGGCTCTCAAGCCCCTTCTGGG - Intronic
1089571691 11:119415579-119415601 CAGCCATCACAGCCCCTTCCTGG + Intergenic
1090225652 11:125070741-125070763 CAGGCTCACATGCCCCTTCTGGG - Intronic
1090992064 11:131826733-131826755 CAGTCTCAAAAGTCCCTTTCAGG + Intronic
1094746725 12:33353330-33353352 CAGGAGCTAAAGACCCTTCCTGG + Intergenic
1095705824 12:45235941-45235963 CAGCCTCCAGTGCCCCTTCCGGG + Intronic
1096500786 12:52062878-52062900 CAGGCTCTCAGGCCTCTTCCTGG + Intergenic
1097836103 12:64274122-64274144 CAGGCCTCAGGGCCCCTTCCTGG - Intronic
1101013585 12:100476153-100476175 CTGACTCCAAAGCCTCTTCCTGG + Intronic
1101673663 12:106898770-106898792 GAGGCAACAAAGGCCCTTCCCGG + Intergenic
1102146092 12:110656107-110656129 CAGTCCCCAAGGTCCCTTCCAGG - Intronic
1102817526 12:115879716-115879738 CAGGGTCCTAGGCCCCATCCTGG - Intergenic
1103402715 12:120654301-120654323 CAACTTCCTAAGCCCCTTCCAGG - Intronic
1103565533 12:121813435-121813457 CAGGCTGCAGAACCACTTCCTGG + Intronic
1105438882 13:20399750-20399772 CAGGCTACCAAGCAACTTCCTGG + Intergenic
1105828984 13:24147562-24147584 CAAGCTGTTAAGCCCCTTCCAGG + Intronic
1106162581 13:27214341-27214363 CAGGGTCCAAAGACCATTGCGGG + Intergenic
1107648150 13:42516446-42516468 CAGGCTTCAACCCCCTTTCCAGG - Intergenic
1112054322 13:95676819-95676841 CAGGCTGCAAAGGCCCTTTTGGG - Intergenic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1112632901 13:101181252-101181274 CAGCCTCCAAACCCTCTGCCTGG - Intronic
1113046392 13:106159762-106159784 CTGGCTCCAGCGCCCCTCCCAGG - Intergenic
1114736916 14:25051152-25051174 CAGGCTCAAAAGTGCCTTCCGGG - Intergenic
1115905779 14:38201564-38201586 GAGGCTCCAAACCCACTTCCAGG - Intergenic
1118590877 14:67399893-67399915 CAGTCACAAAAGCACCTTCCTGG + Intronic
1119398622 14:74347611-74347633 CAGGCTGGAAAGCCCCTTGGGGG + Intronic
1121089409 14:91170761-91170783 CTGGTTCCACAGACCCTTCCTGG + Intronic
1121520963 14:94586031-94586053 CAGGCTCTGAAGCCACTGCCTGG - Intronic
1121605330 14:95236311-95236333 AATGCTCCAAACCCCCCTCCAGG + Intronic
1121712034 14:96045559-96045581 AGAGCTCCAAAGCCCCATCCAGG - Intronic
1122487223 14:102089283-102089305 CCTGCTCCAAAGCCCCTCCCTGG + Intronic
1123480466 15:20626872-20626894 TGGGGTCAAAAGCCCCTTCCTGG + Intergenic
1123637542 15:22373495-22373517 TGGGGTCAAAAGCCCCTTCCTGG - Intergenic
1124688224 15:31800211-31800233 CAGGCTCTAAAGCTCCTACTTGG - Intronic
1124802995 15:32853005-32853027 CAGGCTACAAAGGGCATTCCAGG - Intronic
1124853301 15:33361836-33361858 CAGATTCCTAAGCCCCATCCCGG - Intronic
1125735393 15:41921561-41921583 GTGGCTCCAAAGCATCTTCCCGG - Intronic
1128252105 15:66170925-66170947 CAGGCTCCAAAGCCCTGCCCCGG + Intronic
1128514930 15:68336035-68336057 TACCCTCCAAACCCCCTTCCTGG - Intronic
1130649752 15:85755821-85755843 AGGGCTCCAAAGCCATTTCCAGG - Intergenic
1132342019 15:101084979-101085001 CAGCCTCCAAAACCCCCTCCTGG + Intergenic
1132390752 15:101436586-101436608 CAAGCTCCAAAGCCTCCTCCAGG + Intronic
1132497659 16:271315-271337 CAGCCCCCATACCCCCTTCCAGG - Exonic
1132554380 16:566153-566175 TGGGCTCCAGAGCCCATTCCAGG - Intergenic
1132870069 16:2111998-2112020 CAGGCTCCCAAGCCACGTGCGGG + Intronic
1133347279 16:5079285-5079307 CAGGCTGAAATGCCCCCTCCAGG + Intronic
1133447921 16:5878014-5878036 TAGTCTCCAATGCCCCTTACTGG - Intergenic
1134100204 16:11446704-11446726 CTGGCTCTCAGGCCCCTTCCGGG + Intronic
1134522470 16:14924952-14924974 CAGGCTCCCAAGCCACGTGCGGG - Intronic
1134710140 16:16323603-16323625 CAGGCTCCCAAGCCACGTGCGGG - Intergenic
1134717354 16:16363603-16363625 CAGGCTCCCAAGCCACGTGCGGG - Intergenic
1134949463 16:18345042-18345064 CAGGCTCCCAAGCCACGTGCGGG + Intergenic
1134957398 16:18388556-18388578 CAGGCTCCCAAGCCACGTGCGGG + Intergenic
1135276622 16:21118849-21118871 CAGGCTGCAAAGTTCCTGCCTGG + Intronic
1135354519 16:21758109-21758131 CAGGATCCAATGCCACTCCCTGG - Intronic
1135453007 16:22574249-22574271 CAGGATCCAATGCCACTCCCTGG - Intergenic
1137926844 16:52547725-52547747 CAGGCCCCAACACCCCTTCTGGG - Intronic
1138506332 16:57480091-57480113 CAAGAGCAAAAGCCCCTTCCTGG + Intronic
1139116283 16:63957864-63957886 GAGGCTCCAGAGACCCCTCCTGG - Intergenic
1139952831 16:70680300-70680322 CCGGCGCCAAAGACCGTTCCAGG + Intronic
1140482902 16:75272074-75272096 CAGAGACCAGAGCCCCTTCCAGG + Intergenic
1140730740 16:77853631-77853653 CAGGCTGCAGGGCCCCATCCTGG + Intronic
1140812177 16:78588964-78588986 CACTCTCCAAAGCCTCTTGCTGG + Intronic
1141518031 16:84559437-84559459 CAGCCTCCACAGCCCCCTCCTGG + Intergenic
1141847720 16:86622225-86622247 CAGGCCCCACAGCCCATCCCAGG + Intergenic
1141932841 16:87217247-87217269 CGCTCTCCAAAGCCCCTTCCTGG - Intronic
1141994726 16:87629027-87629049 GAGTCTCCAAGGCTCCTTCCAGG + Intronic
1142224680 16:88871753-88871775 CAGGCTCCCATTCCCTTTCCTGG - Intergenic
1142371778 16:89686629-89686651 CAGGCGCGAAAGCTCCTTCCCGG - Intronic
1145712815 17:26992501-26992523 CTGGCTTCAAACCCCCTGCCAGG - Intergenic
1146796531 17:35785066-35785088 CAGACTCCACAGCCACTCCCAGG - Intronic
1147229909 17:39010008-39010030 GAGGCCCCAAAGCCCCATCATGG + Intergenic
1147986832 17:44311834-44311856 CAGGCCCCCAAGCCCCTTCCAGG + Intronic
1148177375 17:45578956-45578978 CAGGCTCGAATCCCTCTTCCTGG - Intergenic
1149299689 17:55293726-55293748 CTGGCACCAAAGCCCATTCATGG + Intronic
1151699969 17:75737753-75737775 CAGGGTCCCCAACCCCTTCCTGG + Intronic
1152151189 17:78602417-78602439 CTGGCTCCCAGGCCCCTCCCAGG + Intergenic
1152246397 17:79186885-79186907 CACCCTCCAAGGCCCCTGCCAGG - Intronic
1152646715 17:81472374-81472396 CAGGCTCTACAACCCCATCCTGG - Intergenic
1152945288 17:83194586-83194608 CAGGCCCCTCAGCCCCTTCCAGG - Intergenic
1155341181 18:24815896-24815918 CAGGCTCCACAGCACTTTCTGGG + Intergenic
1157582618 18:48782303-48782325 CAAGCTCCAGGGCCCCTGCCTGG + Intronic
1159828885 18:73249332-73249354 CGGCCACCAAAGCCCCTTACAGG + Intronic
1160349647 18:78165637-78165659 CAGGCTCCAGAGGCCCTCTCAGG - Intergenic
1160470619 18:79129452-79129474 CAGGCTCCAAAGCCCAGGACAGG + Intronic
1160970069 19:1764023-1764045 CAGCCTCCCCAGCCCCTTTCTGG + Intronic
1161459024 19:4385565-4385587 CGGGCCCCAAAGACCCTCCCTGG + Intronic
1161692216 19:5742829-5742851 CAGGATCTAGAGTCCCTTCCAGG + Intronic
1162788469 19:13050982-13051004 CAGGCCCCAAAGCAGCCTCCAGG + Intronic
1163276289 19:16286428-16286450 TTGGCTCCGAAGCCCCTTTCAGG + Intergenic
1163785604 19:19273381-19273403 GAGCCTCCAAGGCCCCTCCCCGG + Intronic
1166777606 19:45322508-45322530 CTGGCTCAACAGCCCCTTGCAGG + Intronic
1168433225 19:56297634-56297656 CAGGTACCAAAGCCCCTGCAGGG - Intronic
926279999 2:11438264-11438286 CAGGAACCAAGGCCCCTTCCAGG - Intergenic
926843400 2:17107081-17107103 CAGGCTCTGAACCCCCTTCAGGG + Intergenic
928167914 2:28984121-28984143 CAGGCTCCAGAGCCACTGTCTGG + Intronic
928649786 2:33391985-33392007 CAGGCTCCAAAAGCCCTTGCTGG - Intronic
931443509 2:62307784-62307806 CAGGCTCCTCGGCCCCTCCCTGG - Intergenic
933846805 2:86333330-86333352 CATGCTCCAAATCCCAGTCCTGG + Intronic
934664112 2:96158132-96158154 CAGCTTCCAAAACACCTTCCCGG - Intergenic
935250085 2:101253155-101253177 CAGGCTCGAGAGCTCCTTCGGGG - Exonic
937277456 2:120694571-120694593 CAGCGTCAAAAGCCCTTTCCAGG - Intergenic
937885976 2:126900183-126900205 CAAGCTCCAGAGCCCCTTGGAGG + Intronic
937928069 2:127183041-127183063 GCGGCTCCACAGCCCCTTCCCGG - Intergenic
938087473 2:128410753-128410775 CAGGCGACATAGCCCCCTCCTGG - Intergenic
938228851 2:129640502-129640524 CAAACTACTAAGCCCCTTCCAGG + Intergenic
938232022 2:129669498-129669520 CAGGGTCCACACACCCTTCCCGG + Intergenic
938694109 2:133819785-133819807 CAGTCTCCCAACCCCCTTTCAGG + Intergenic
939959489 2:148553839-148553861 CAGGCACCAACACTCCTTCCAGG + Intergenic
946154046 2:217795773-217795795 CAGCCTGCAAAGCCTCTTCCAGG + Intergenic
947418407 2:229921496-229921518 CAAGCTCCAAAGCCCACTTCCGG + Intronic
948166286 2:235865250-235865272 CAGGCTTCAAAGCGCCGGCCGGG - Intronic
948287612 2:236798648-236798670 TTTGCTCCAAAGCCCCCTCCAGG - Intergenic
948656407 2:239479411-239479433 CAGGCTCCAAAACCTCTGCAAGG - Intergenic
948789848 2:240371581-240371603 CAGCCTGCAGGGCCCCTTCCAGG - Intergenic
1170319054 20:15074407-15074429 CAATCTTCCAAGCCCCTTCCAGG - Intronic
1171444565 20:25194759-25194781 CAAGGGCCAGAGCCCCTTCCCGG - Intergenic
1172096982 20:32465311-32465333 CAGGCCCCAAAGCACCACCCAGG + Intronic
1172885530 20:38228371-38228393 CAAGTTCCAATGCCCCTTCTAGG + Intronic
1172888423 20:38246989-38247011 CAGGCTTCACCGCCTCTTCCAGG + Intronic
1173199801 20:40946067-40946089 CCGGCTGCACAGCCTCTTCCAGG + Intergenic
1173930231 20:46811632-46811654 CAGGCACCAAAGTCTCCTCCGGG + Intergenic
1174554858 20:51386776-51386798 CAGGCTCAGAAGCCACTTGCCGG - Intergenic
1174570205 20:51496037-51496059 CAGGTTCCAAACCCCCACCCAGG + Intronic
1175925106 20:62467578-62467600 CAGGTTGCACAGCCCCTGCCTGG + Intronic
1176277276 20:64279601-64279623 AAGGCACCATGGCCCCTTCCAGG + Intronic
1179478950 21:41665825-41665847 CAGGTTGCATGGCCCCTTCCAGG + Intergenic
1181476091 22:23168675-23168697 CAGGCAGCACAGACCCTTCCTGG + Intergenic
1182106705 22:27694941-27694963 CAGGTTCCAAATGCCCCTCCCGG + Intergenic
1182518054 22:30870150-30870172 CCGCCTCCAAAGCCCAGTCCCGG + Intronic
1182725569 22:32442518-32442540 CATCCTCCCAAGCACCTTCCCGG + Intronic
1182834038 22:33326948-33326970 CAGTCTCCAAAGGACCCTCCAGG - Intronic
1183245122 22:36687489-36687511 CAAGCTCTAAAGCCTTTTCCAGG + Intronic
1183271078 22:36862931-36862953 CAGGCTCCAAAACCTCCCCCAGG + Intronic
1183343214 22:37293600-37293622 CAGGCTCCCAAGTCCCATGCTGG + Intronic
1185083574 22:48723546-48723568 CAGACTGACAAGCCCCTTCCAGG + Intronic
1185367823 22:50445109-50445131 CCGGCCCCAAAGCCCCGGCCCGG + Exonic
949345545 3:3072989-3073011 CAGGCACCAAAGCTCCACCCTGG + Intronic
949471562 3:4401940-4401962 CACTCTCCAAAGCCCCTAGCTGG + Intronic
950141527 3:10619346-10619368 CAGGCTCCCAGGCCCCATCCAGG + Intronic
950149865 3:10678546-10678568 CATGCTCCCAGGCCCCTTCTAGG - Intronic
951387801 3:22063848-22063870 CAAGCTCCAGAGCTCCTTACGGG + Intronic
952384229 3:32827746-32827768 CAGGCTCCAAGGTCCATTCAAGG - Intronic
954577916 3:51686911-51686933 CAGCCACCAAAGCCTTTTCCTGG + Intronic
956575552 3:70748762-70748784 TGGGCTCCAAAGCCTCTTGCTGG - Intergenic
956766296 3:72487327-72487349 CTGGCTCCCAAGCCCCCTCTGGG - Intergenic
957051675 3:75416448-75416470 CAGGCTGAAATGCCCCCTCCAGG + Intergenic
960051303 3:113241632-113241654 AAGGCACCACTGCCCCTTCCCGG - Intronic
961302800 3:125933146-125933168 CAGGCTGAAATGCCCCCTCCAGG - Intronic
961416896 3:126765822-126765844 CAGACTCCCAATCCCCCTCCAGG + Intronic
961885265 3:130092626-130092648 CAGGCTGAAATGCCCCCTCCAGG + Intronic
962200565 3:133398295-133398317 CAGGCTCGCATGCCCCTTCTGGG + Intergenic
967197828 3:187044051-187044073 CAGTCTACAAACTCCCTTCCTGG - Intronic
968521674 4:1037149-1037171 CAGGCCCCACTGCCCCTCCCAGG - Intergenic
968994457 4:3936828-3936850 CAGGCTGAAATGCCCCCTCCAGG + Intergenic
969819480 4:9709408-9709430 CAGGCTGAAATGCCCCCTCCAGG - Intergenic
971013082 4:22460442-22460464 AAGGGTCCAAAGCCCTCTCCTGG - Intronic
976262335 4:83157695-83157717 CAAGCTACAAATGCCCTTCCAGG - Intergenic
976617951 4:87097169-87097191 CAGGCTTTAACGTCCCTTCCTGG - Intronic
984878606 4:184391001-184391023 CAGGGACCAGCGCCCCTTCCTGG - Intronic
987078926 5:14409042-14409064 GAGACTCCAGAGCCCCTTCCTGG - Intronic
987372658 5:17207515-17207537 CAGCCTCCAGAGCTCCTTCTTGG - Intronic
989363918 5:40634624-40634646 CTGGCTTCAACGCCCTTTCCAGG - Intergenic
992531199 5:77653277-77653299 CAGGCTCTCAAGCCACTTCCAGG + Intergenic
997998647 5:138606574-138606596 CAGGCACTGAAGCCCCTACCCGG + Intergenic
1000216156 5:159158723-159158745 TGGGGTCAAAAGCCCCTTCCTGG + Exonic
1001562571 5:172678954-172678976 CACTCTCCCAAGCCACTTCCAGG - Intronic
1002534709 5:179869871-179869893 ATGGCTGCAGAGCCCCTTCCAGG + Intronic
1002974247 6:2058617-2058639 CAGGCTCCACATCCCTTCCCAGG - Intronic
1003665877 6:8110945-8110967 AAGGCTTCAAAGTCCCTTTCTGG + Intergenic
1006245559 6:32731429-32731451 CAGCCTCCAGAGCCCCATCACGG - Intergenic
1006272135 6:32972755-32972777 CAGGCGACAAACCCCCTGCCTGG - Exonic
1007132216 6:39486016-39486038 CAGCCTCCAGAGTCCCTGCCAGG + Intronic
1007815610 6:44522984-44523006 CAGCCTCCATAGCTCCATCCAGG - Intergenic
1016325146 6:142892432-142892454 CAGGCTCCAAAGACTCTTGGGGG - Intronic
1018044361 6:159952689-159952711 CAGACTCCAAAGCCGCCCCCAGG - Intergenic
1018083500 6:160278871-160278893 CACGATCTAGAGCCCCTTCCTGG + Intergenic
1018103771 6:160464548-160464570 CATTCTCCAAAGACCCTTCAGGG - Intergenic
1018112067 6:160545762-160545784 CATTCTCCAAAGACCCTTCAGGG - Intronic
1018443541 6:163834686-163834708 CAGCCACCAAAGCCCGTGCCAGG + Intergenic
1020026865 7:4905546-4905568 CGGACACCAAAGCACCTTCCTGG - Intergenic
1022103129 7:27180861-27180883 CAGGCCCCAAGGCCCTCTCCAGG + Intergenic
1023503624 7:40876868-40876890 CAGGCTGCACAGGCCCCTCCAGG - Intergenic
1026955518 7:74374007-74374029 CAGGCCCCACAGTCCCCTCCAGG + Intronic
1029682554 7:102121844-102121866 CGGTCTTCAAAGCCCCTTTCTGG + Intronic
1034307812 7:150059814-150059836 CAGGCTTGAAATCCTCTTCCCGG + Intergenic
1034799035 7:154040855-154040877 CAGGCTTGAAATCCTCTTCCCGG - Intronic
1035187596 7:157138719-157138741 CAGGCTCCAGCGCGCCTTGCGGG + Intergenic
1035283826 7:157793974-157793996 AGGGCCCCACAGCCCCTTCCCGG + Intronic
1035384194 7:158459422-158459444 CAGAATCCAGAGCCCCTGCCTGG + Intronic
1036216263 8:6882638-6882660 ATGGCTCCTCAGCCCCTTCCTGG - Intergenic
1040610479 8:48977702-48977724 AAGGCTCCAAAGGCTCCTCCAGG + Intergenic
1040738391 8:50539720-50539742 CAGGCTCCAATTTCCCTGCCAGG - Intronic
1041095163 8:54342573-54342595 CTGGCTACACAGCCCCTTCTTGG + Intergenic
1041381557 8:57258638-57258660 CCGGCCACCAAGCCCCTTCCAGG + Intergenic
1043322532 8:79007534-79007556 CAGTCTCCAGAGTGCCTTCCTGG - Intergenic
1045378456 8:101599535-101599557 CTGACCCCATAGCCCCTTCCAGG + Intronic
1047229033 8:122980271-122980293 CAGTGGCCAAAGCCCCTGCCAGG + Intergenic
1047756805 8:127925122-127925144 CAGGCACAAAAGACCATTCCAGG - Intergenic
1047916729 8:129591853-129591875 CAGGGTCCTGACCCCCTTCCAGG + Intergenic
1049338694 8:142100428-142100450 TGTGCTCCAGAGCCCCTTCCAGG + Intergenic
1049817843 8:144616240-144616262 CTGGCAGCACAGCCCCTTCCTGG + Intergenic
1049983619 9:927680-927702 CAGGTTCCAAATGCGCTTCCTGG + Intronic
1050583439 9:7085165-7085187 AGGGCTCCAATGCCCCTTCCTGG - Intergenic
1054721533 9:68609008-68609030 CAGCCTCCAGAGCCCGCTCCTGG - Intergenic
1055355030 9:75428806-75428828 CAGGCTCCGAAGTACATTCCAGG + Intergenic
1055611205 9:78026767-78026789 CAGCCTTCCAAGCCCCTTCTTGG + Intronic
1055987091 9:82063105-82063127 CTGGCTCATCAGCCCCTTCCTGG - Intergenic
1056848941 9:90064834-90064856 CAGGCTCCACTGCCCCAACCAGG + Intergenic
1057160085 9:92883132-92883154 CTGGCTCATCAGCCCCTTCCTGG + Intergenic
1057267638 9:93629761-93629783 CAGGCTGCAGAGGCCTTTCCAGG + Intronic
1057276964 9:93681118-93681140 CAGCCGCAGAAGCCCCTTCCAGG - Intergenic
1058980810 9:110168510-110168532 CAAGCACCAAAGACGCTTCCTGG - Exonic
1059305428 9:113349842-113349864 CAGGCTCCCCAGTCCCTGCCGGG - Intronic
1059938492 9:119335161-119335183 CAGTTTCCAAAGGCCCTTCTGGG - Intronic
1060156107 9:121320926-121320948 CAGGCCCCTCATCCCCTTCCGGG - Intronic
1060775261 9:126368386-126368408 CAGGCTCCAAAGCCCCTTCCTGG - Intronic
1060798127 9:126526440-126526462 CAGGCTCCTCAGCCTCCTCCCGG - Intergenic
1061144146 9:128787374-128787396 CAGGCCCCATGGCCCCTTACCGG - Exonic
1061591109 9:131598165-131598187 CAGGCTGCAAAGCCCCAGCCCGG + Intronic
1061837223 9:133337237-133337259 AAGGACCCAGAGCCCCTTCCAGG + Intergenic
1062306207 9:135908123-135908145 CAGTCTCCAGACCCCCGTCCCGG + Intergenic
1062433189 9:136535056-136535078 CAGGCCCCAGACCTCCTTCCAGG + Intronic
1062672092 9:137716988-137717010 CATGCTGCAAAAACCCTTCCTGG + Exonic
1062685587 9:137811351-137811373 CATGCTCCAGAGCCTCTCCCCGG + Intronic
1185507766 X:642824-642846 CAGGTCCCAAAGGCCCTCCCAGG - Intronic
1185508089 X:643860-643882 CAGGCTCCCAAGCCTCTCCCGGG - Intronic
1186625867 X:11292804-11292826 CAGGGGACAAAGCCCCTTCTCGG - Intronic
1190461211 X:50677751-50677773 CAGGCTCTGAAGCCACGTCCTGG + Intronic
1190995707 X:55606470-55606492 CTGGCTTCAAACCCCTTTCCAGG + Intergenic
1192576364 X:72246202-72246224 CAGGCCTCAAAGACACTTCCCGG - Intronic
1194159830 X:90436612-90436634 CAAGCTCTCCAGCCCCTTCCAGG - Intergenic
1195614573 X:106902336-106902358 AAGGCTCCTGAGCCCATTCCAGG + Intronic
1195685247 X:107579142-107579164 CAGGGTCCAAAGCCACAGCCTGG + Intronic
1196080776 X:111628119-111628141 CTGGATCCACAGTCCCTTCCTGG + Intergenic
1197728422 X:129791636-129791658 CAGAACCCAAAGCCCCTGCCTGG - Intronic
1199549328 X:149041223-149041245 CAGGATTCAAAGCTCTTTCCTGG - Intergenic
1200506130 Y:4013578-4013600 CAAGCTCTCCAGCCCCTTCCAGG - Intergenic