ID: 1060779520

View in Genome Browser
Species Human (GRCh38)
Location 9:126401128-126401150
Sequence CAGTGTTAGGGAAAGGTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060779520_1060779527 -10 Left 1060779520 9:126401128-126401150 CCTGTGACCTTTCCCTAACACTG 0: 1
1: 0
2: 2
3: 15
4: 183
Right 1060779527 9:126401141-126401163 CCTAACACTGTCTCTCTTGGGGG No data
1060779520_1060779529 -4 Left 1060779520 9:126401128-126401150 CCTGTGACCTTTCCCTAACACTG 0: 1
1: 0
2: 2
3: 15
4: 183
Right 1060779529 9:126401147-126401169 ACTGTCTCTCTTGGGGGAAAGGG No data
1060779520_1060779528 -5 Left 1060779520 9:126401128-126401150 CCTGTGACCTTTCCCTAACACTG 0: 1
1: 0
2: 2
3: 15
4: 183
Right 1060779528 9:126401146-126401168 CACTGTCTCTCTTGGGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060779520 Original CRISPR CAGTGTTAGGGAAAGGTCAC AGG (reversed) Intronic
902615937 1:17623569-17623591 CAGTGCTGGGGAAAGGGCACTGG + Intronic
902827948 1:18989912-18989934 CAGTGGTGGAGAATGGTCACAGG + Intergenic
904506958 1:30964968-30964990 AAGTGTTAGGAACAGGTCACTGG - Intronic
906409699 1:45568693-45568715 CAGTCTTAGGGAGAGGGCCCTGG + Intronic
907815052 1:57910565-57910587 AAGTGTTAGGGAAAGGTCAGGGG + Intronic
912804428 1:112744134-112744156 CAGGGTTAGGGACGGGTGACCGG - Intergenic
914620780 1:149405498-149405520 CAGTGGTAAAGAACGGTCACTGG + Intergenic
915586036 1:156844513-156844535 CAGGGTTAGGGCAACCTCACTGG - Exonic
916582346 1:166120335-166120357 CAGTGTGATGGAAAGCACACAGG - Intronic
918792881 1:188853365-188853387 CAATGGTAGGGATAGGTCAATGG - Intergenic
918849121 1:189661596-189661618 CAATGTTAGGTAAAGGGTACAGG + Intergenic
919123283 1:193367067-193367089 CAGGGTTAGGGAAACTTCACAGG + Intergenic
919770578 1:201155630-201155652 CAGTGTGATGCAAAGGTCAGGGG + Intronic
920577859 1:207075182-207075204 CAGCATTAGAGACAGGTCACTGG + Exonic
923852669 1:237814528-237814550 CAGTGTTATAGACAAGTCACAGG + Intronic
1063647990 10:7904949-7904971 CAGTGTGAGGGAAAGGATGCAGG - Intronic
1064498629 10:15943601-15943623 TAGTGTTAGGAAAAAATCACAGG - Intergenic
1064513245 10:16118180-16118202 CAGTGTGAGGGAAAGGTGAGAGG - Intergenic
1068911624 10:62384166-62384188 CAGTGTTGGGGAAATTTAACTGG - Intronic
1069178918 10:65331870-65331892 CATTGGTAGAGAAAGATCACTGG + Intergenic
1070932407 10:80270718-80270740 CAGTGTTAGGGAAATGTGGACGG - Intergenic
1071256321 10:83875182-83875204 TAGTGTTAGTGATAGGTCAGGGG - Intergenic
1072978746 10:100081546-100081568 CGGTGGTGGCGAAAGGTCACCGG + Exonic
1073480995 10:103785928-103785950 GAGGCTCAGGGAAAGGTCACAGG + Intronic
1073818949 10:107238015-107238037 CAATTTTAAGGAAAGGTCTCAGG - Intergenic
1076243664 10:128929199-128929221 CACTGTTCGGGGAAGGTTACAGG + Intergenic
1077491947 11:2865041-2865063 ATGTGTTAGGGAAAGGCCCCAGG - Intergenic
1079949346 11:26782951-26782973 CAGTGGTAGGGAAATGACAATGG - Intergenic
1079964319 11:26962129-26962151 CATTCTTAGGGAAAGGTCTTAGG + Intergenic
1081654415 11:44848157-44848179 CTGTGTTAGGGAAGGCTGACAGG + Intronic
1082751487 11:57022868-57022890 CAGTGATACGGAAAGGAGACAGG - Intergenic
1082762763 11:57143387-57143409 CAGTGTAATGGAAAGAGCACTGG - Intergenic
1083348838 11:62013024-62013046 CAGTGTTAGGGAGAACTCCCTGG - Intergenic
1083655934 11:64229698-64229720 CAGTGCAAGGGAAAGGTCCAGGG + Intronic
1085201268 11:74703654-74703676 CAGTGTCAGGGAGAGGGGACAGG - Intronic
1088179130 11:107089276-107089298 CAATGTAAGGGAAAGGTTAGGGG - Intergenic
1093163266 12:15774523-15774545 CAAGGTAAGGGAAAGGTTACAGG + Intronic
1094511716 12:31101224-31101246 CAGTGTTGGGGAAATTGCACAGG + Intronic
1098912420 12:76222628-76222650 CACTCTAAGGGAAAGGTGACTGG + Intergenic
1101655115 12:106713163-106713185 GTGTGTTTGGGAAAGCTCACTGG - Intronic
1106243414 13:27927618-27927640 CAGTGTTCGGGAAAGATGAGTGG - Intergenic
1110047315 13:70846285-70846307 CTGTGGTAGGAAAAGGTCAATGG - Intergenic
1115148346 14:30253571-30253593 CACTGTTAGGGAAAGCCCACTGG - Intergenic
1115501873 14:34057356-34057378 CCCTGTTAGGGAAATGTCAGGGG + Intronic
1116562087 14:46392731-46392753 CAGTGTACAGTAAAGGTCACTGG - Intergenic
1117380556 14:55158215-55158237 CAGTCTATGAGAAAGGTCACAGG - Intronic
1118171065 14:63389022-63389044 CAGTGCTATGGGAAGGTCACCGG + Intronic
1121827337 14:97021130-97021152 CAGTGACAGGGAAAGCACACAGG + Intergenic
1122201334 14:100124393-100124415 CAGTCTTAGGAAAAGGCCAGAGG - Intronic
1122427442 14:101620168-101620190 CAGGGTCAGGCACAGGTCACAGG + Intergenic
1125115780 15:36089786-36089808 CAGGGTTATGGAGAGCTCACAGG + Intergenic
1126640437 15:50819416-50819438 CAGTTTTAGGAAAAGATAACAGG + Intergenic
1126789898 15:52211561-52211583 CACTGTTAGGGAAAGATAAATGG - Intronic
1128108793 15:65063305-65063327 CAGTGTCTGGGAAAGGACAAGGG - Intronic
1136011132 16:27363969-27363991 CAGTGTTAGGCCAACGTCAGTGG - Exonic
1140048144 16:71456316-71456338 CAGGGGTAAGGGAAGGTCACAGG - Intronic
1141142220 16:81504021-81504043 CAGTGTTAGAAAAAGGTCAGTGG + Intronic
1141320391 16:83003096-83003118 CAGTGTTGGGGAAAGGACACTGG - Intronic
1141468308 16:84221663-84221685 CAGCATTAGGGAAATATCACTGG + Exonic
1143371068 17:6439788-6439810 CAGTGCTAGGGAGAAGTGACAGG - Intergenic
1145312395 17:21707787-21707809 CAGTGTTAGGGAGAAGCCAGGGG - Intergenic
1146038617 17:29430566-29430588 CAGTGCTCAGGAAAGGTCAAAGG + Intronic
1148216865 17:45838041-45838063 CAGTGGTGGGGGAAGGTCGCTGG + Intergenic
1148652689 17:49260919-49260941 GAGTGTTGGAGAAAGGGCACAGG - Intergenic
1149498554 17:57134495-57134517 CAGTGTTAGGGGAAAGGCAGGGG - Intergenic
1150309227 17:64113976-64113998 TAGATTTAGGTAAAGGTCACCGG - Intronic
1152729703 17:81963416-81963438 CAGGCATAAGGAAAGGTCACAGG - Intergenic
1154415159 18:14172285-14172307 CAGTGCCAGGGAAAGGGCAAGGG + Intergenic
1155730152 18:29147047-29147069 CAGTGCTAGGTAAATGGCACGGG + Intergenic
1156234032 18:35183712-35183734 CAGTATAGTGGAAAGGTCACTGG + Intergenic
1156331916 18:36130564-36130586 CAGTTTGGGGGAAAGGTCATAGG + Intronic
1158982382 18:62776134-62776156 CAGTTTTAGGGCAAGCTGACAGG + Intronic
1160058570 18:75509269-75509291 CAGAATTGGGGAAGGGTCACTGG + Intergenic
1163345976 19:16742493-16742515 CAGAGTTAGTCCAAGGTCACAGG - Intronic
1163497347 19:17654689-17654711 CAGGGTTAGGGAAAGGTCTGGGG - Intronic
1164643132 19:29840912-29840934 CAGCGTTGGAGAAAGGTCTCAGG + Intergenic
1166076410 19:40416135-40416157 GAGTGTGAGGGAAAGGTAAGAGG + Intergenic
1166352282 19:42205153-42205175 CAGTCTTCGGGAAATGCCACAGG + Intronic
1166367716 19:42285742-42285764 CAGTGTGAGGGGAAGCCCACTGG + Intronic
1166439877 19:42804006-42804028 CAGTATTAGTGAAACATCACTGG - Intronic
1167301151 19:48678499-48678521 CAGAGTTTGGGAAAGAGCACAGG - Intergenic
1168019829 19:53601186-53601208 CAGCTATAGGGAAAGGTCGCAGG + Intronic
1168589687 19:57622538-57622560 TACTGTTAGGTCAAGGTCACTGG + Exonic
1168652137 19:58098073-58098095 CAGCGTTAGGGAAAGGGGCCAGG - Intronic
928243900 2:29610687-29610709 CTGTGAAAGGAAAAGGTCACTGG + Intronic
928861582 2:35863669-35863691 CAGTGTTAAGAACAGGTCATTGG + Intergenic
929325465 2:40605469-40605491 CAGGTTTAGGGAAAGAGCACAGG + Intronic
931369497 2:61649224-61649246 AAGTGTTACTGAAATGTCACGGG + Intergenic
932563647 2:72892485-72892507 CAGAGTTGGGGAAAGGACCCAGG - Intergenic
932831353 2:74993403-74993425 CAGAGTTGGGGAAAGGACAAGGG + Intergenic
933738157 2:85511939-85511961 CAGTGTTATGGAAAGAGCATAGG + Intergenic
934474069 2:94581111-94581133 CCGTGTCATGGAAAGGACACGGG - Intergenic
935085300 2:99838840-99838862 GAGTGTGATGGAACGGTCACTGG - Intronic
937803649 2:126111261-126111283 CATTGTTTGGGCAAGGTCAAGGG + Intergenic
939257952 2:139769309-139769331 CAGTGAAAGAGAAAGGTCACTGG + Intergenic
940440815 2:153714008-153714030 AAGTCTTAGGGAAAGTTCCCAGG + Intergenic
941903693 2:170701312-170701334 CAGTGCTGGTGAAAGGGCACAGG + Intergenic
944466900 2:200010956-200010978 CATTGTTAGGGAGAGGTCTCTGG - Intergenic
946847995 2:223878169-223878191 AAGTCATAGGGAAAGGTCTCTGG + Exonic
947926124 2:233924135-233924157 CAGTGTCAGGAGAAGGTCCCTGG - Intronic
948063390 2:235058663-235058685 CACTGATGGGGAAAGGTCCCAGG - Intergenic
1169333634 20:4736940-4736962 CAGTGATAGGGAAACATCAGAGG + Intronic
1170601552 20:17845359-17845381 CAGTGTAAGGGAATGGGCTCTGG - Intergenic
1173466493 20:43286750-43286772 CATTGTTATGGAAAAGTCAGAGG - Intergenic
1174284085 20:49460023-49460045 TAGTGATAGGGAAAGGGCTCTGG + Intronic
1176866423 21:14057177-14057199 CAGTGCCAGGGAAAGGGCAAGGG + Intergenic
1177400755 21:20602074-20602096 TAGTGTTAGAGAAAGGACATGGG + Intergenic
1178172307 21:30055135-30055157 TATTGTTAGGAAATGGTCACTGG - Intergenic
1178639033 21:34331142-34331164 CAGTGTTGGTGAGAGGTGACTGG + Intergenic
1179554993 21:42167468-42167490 TAGTGCCTGGGAAAGGTCACAGG - Intergenic
1179663438 21:42893108-42893130 CAGCGTGAGGGACACGTCACCGG - Intronic
1180033359 21:45227829-45227851 CAGTGTCAGGGAATGGTGCCTGG + Intergenic
1183550866 22:38483990-38484012 CTGTTTGAGGGAAAGGTCTCTGG - Exonic
1185143747 22:49118143-49118165 CAGTAACAGTGAAAGGTCACGGG - Intergenic
949383438 3:3470984-3471006 CAGTGTTAGGAATAGATCTCTGG - Intergenic
950952390 3:17014138-17014160 CACTAATAGGGGAAGGTCACAGG + Intronic
953355990 3:42256777-42256799 TAGTGTTGGGGACAGGACACTGG - Intergenic
953601645 3:44371701-44371723 CATGCTTAGGGAAAGGTCAAGGG - Intronic
958663857 3:97108195-97108217 GAGTGTTAGGGGAAAGTCAGTGG + Intronic
958819172 3:98952806-98952828 CAGAATAAGGGAAGGGTCACAGG - Intergenic
959727589 3:109561414-109561436 CAGAATTAGGGAGGGGTCACAGG - Intergenic
960769595 3:121178870-121178892 CAGAATTAGGGAAGAGTCACAGG + Intronic
962270054 3:133971029-133971051 CAGTGTGAGGCAAATGCCACTGG + Intronic
962308691 3:134311061-134311083 AAGTGTGCGGGAAAGGTCATGGG + Intergenic
962321257 3:134392482-134392504 CAGTGTTTGGCAGAAGTCACAGG + Intergenic
964732408 3:159881636-159881658 TAGTATAAGGGAAAGGCCACTGG + Intronic
967983327 3:195078325-195078347 CAGTGTGAGGGACAGGTGGCCGG - Intronic
968376743 4:50198-50220 CAGGGTTTGGGAGAGGACACAGG + Intergenic
971934477 4:33130201-33130223 CAATTCCAGGGAAAGGTCACTGG + Intergenic
972721465 4:41703270-41703292 ATGTGTTAGGGAGAGGTCAGTGG - Intergenic
974067661 4:57094768-57094790 CAGTGTTTGGAAATGGTCAAGGG - Intronic
974232800 4:59138409-59138431 AAGTGTTGGGGAAGGGTCAGAGG + Intergenic
975335803 4:73173878-73173900 CAGAATTAGGGAGGGGTCACAGG + Intronic
981077209 4:140603552-140603574 CAGAATTAGGGAGGGGTCACAGG - Intergenic
986941235 5:12952344-12952366 CAGAGTCAGAGAAAGCTCACAGG + Intergenic
991215152 5:64151573-64151595 CAGAATTAGGGAAGGGTCACAGG - Intergenic
991410668 5:66342394-66342416 CAGAGTTAGAGACAGGTCTCTGG - Intergenic
991543158 5:67752008-67752030 CAGGATTTGGGAAGGGTCACAGG + Intergenic
994399140 5:99257076-99257098 CAGAACTAGGGAGAGGTCACAGG - Intergenic
994822841 5:104676399-104676421 GAGAATTAGGGAAAGATCACAGG + Intergenic
996097961 5:119419090-119419112 CAGTTTTAGGCAAAAATCACTGG + Intergenic
996205219 5:120725983-120726005 CAATGTTTTGGAAAGGTCTCGGG + Intergenic
998703560 5:144732603-144732625 CAGAATTAGGGAGGGGTCACAGG - Intergenic
998727839 5:145038481-145038503 CACTGTTTGGGAATGGACACAGG - Intergenic
998804240 5:145903122-145903144 CAGGGTAATGCAAAGGTCACAGG + Intergenic
1002304680 5:178276177-178276199 CTATGTTAGGGAAAGGTCCAGGG + Intronic
1004628218 6:17396668-17396690 AAGTGATAGATAAAGGTCACAGG + Intronic
1006350062 6:33514361-33514383 CAGTGTGAAGGAAGGGTCTCAGG - Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006435859 6:34025956-34025978 CAGTGTGAGGGGAAGGCCAAGGG + Intronic
1006566803 6:34966093-34966115 CAGTGTTAGGTTAAAGTCACAGG - Intronic
1006602345 6:35234375-35234397 CAGTGAAAGGGACAGGTCCCTGG - Intronic
1006615993 6:35327328-35327350 CAGGGTGATGGAAAGGACACAGG - Intergenic
1006910009 6:37557606-37557628 GAGAGGTAGGGAAAGGTCAGGGG - Intergenic
1007349427 6:41258130-41258152 CAGAATTAGGGAGGGGTCACAGG + Intergenic
1009243126 6:61203358-61203380 CAGTGTTATGCAAAGGGCTCTGG - Intergenic
1010017615 6:71122861-71122883 CAGAATTAGGGAGGGGTCACAGG - Intergenic
1010350676 6:74870607-74870629 CAATGTGAGGGAAAGGAAACTGG - Intergenic
1010639782 6:78310424-78310446 CAGTGCTAGGGATATGTCAGTGG - Intergenic
1011226677 6:85115733-85115755 CTGTGTTAGGGAGAGGACCCTGG - Intergenic
1013271159 6:108546685-108546707 CAATGTGAGAGAAAGGGCACAGG - Intergenic
1019723423 7:2587218-2587240 CAGGTTTGGGGAAAGGCCACGGG + Intronic
1019886924 7:3913267-3913289 AAGTGTAAGAGAAAGGTCAGAGG - Intronic
1021532205 7:21659500-21659522 AAGACTTAAGGAAAGGTCACAGG - Intronic
1021755042 7:23843435-23843457 CAGAATTAGGGAGAGGTCGCAGG - Intergenic
1024880334 7:54078588-54078610 CTATGTTAGGGAAAGTTCACGGG + Intergenic
1025614953 7:63110354-63110376 CAGTGTTTGGGAAGGGCCATGGG + Intergenic
1026929410 7:74215529-74215551 CAGGGTTAGGGGCAGGACACTGG + Intronic
1028008922 7:85615118-85615140 CAGGGTTAGTGCAAGGGCACTGG - Intergenic
1030823713 7:114128050-114128072 GAATGTTAGGGATAGGCCACAGG + Intronic
1032731999 7:134652628-134652650 CAGAGGCAGGGAAAGGTAACAGG - Intronic
1035951421 8:4025780-4025802 CAGTTTTAAGCAAAGGTGACTGG + Intronic
1036797829 8:11769070-11769092 CAGTTATAGGGAAAAGTCAATGG - Intergenic
1042240121 8:66655192-66655214 CAGATTCAGGGAAAGGTCAGTGG + Intronic
1046448620 8:114358548-114358570 CAGAATTAGGGAGGGGTCACAGG + Intergenic
1048942358 8:139412413-139412435 CATTATAAGGGAAAGGTAACAGG - Intergenic
1049983842 9:929909-929931 CAGGGATAGTGAAAGGTCAGCGG + Intronic
1052681044 9:31693122-31693144 CACTCTTAGGGAAAGGTCATAGG + Intergenic
1053933982 9:43133306-43133328 CCGTGTCATGGAAAGGACACGGG + Intergenic
1054279713 9:63119932-63119954 CCGTGTCATGGAAAGGACACGGG - Intergenic
1054500613 9:65871339-65871361 CCGTGTCATGGAAAGGACACGGG - Intergenic
1057945941 9:99328323-99328345 CAGTGTTATTGAAAAGCCACCGG + Intergenic
1060396679 9:123321267-123321289 CAGTGCCAGGGAAAGGCCCCTGG - Intergenic
1060748661 9:126154579-126154601 CAGTGTCACGGAAAGGGCACAGG + Intergenic
1060779520 9:126401128-126401150 CAGTGTTAGGGAAAGGTCACAGG - Intronic
1061343498 9:130002880-130002902 CAGTGTGAGGTCAAGGTCAAGGG - Intronic
1061926482 9:133808418-133808440 AAGTGCTAGGGAAATGTCCCAGG + Intronic
1203572487 Un_KI270744v1:144048-144070 CAGGGTTTGGGAGAGGACACAGG - Intergenic
1185748909 X:2594685-2594707 CAGTACCAGGGAAGGGTCACAGG + Intergenic
1186067723 X:5784147-5784169 CAGATTTATGGAAAGGTCAATGG - Intergenic
1186370982 X:8947198-8947220 CAGAATTAGGGAAAGGTCGGGGG - Intergenic
1186872511 X:13786384-13786406 GATTGTTTTGGAAAGGTCACAGG + Intronic
1187526401 X:20059008-20059030 CAATGTTAGCTCAAGGTCACAGG - Intronic
1189354260 X:40299204-40299226 CCGTGGTAGGGAAAGGGCAGAGG - Intergenic
1190235685 X:48613642-48613664 CAGTGTCAGGTATAGATCACAGG - Intergenic
1191001318 X:55662645-55662667 CAGTAATGGGGAAAGGCCACTGG - Intergenic
1191081608 X:56517164-56517186 CAGAGTTAAGGAAAGGTAGCAGG + Intergenic
1195837536 X:109134040-109134062 CAGTGTTAGGTAAGGCTCTCCGG - Intergenic
1198580155 X:138054927-138054949 CAGGGTTAAGGAAACATCACAGG + Intergenic
1201917210 Y:19195332-19195354 CAATGTTAGGGTGAGATCACTGG + Intergenic
1201928745 Y:19318233-19318255 CAGTGTTATCTGAAGGTCACTGG + Intergenic