ID: 1060781165

View in Genome Browser
Species Human (GRCh38)
Location 9:126414389-126414411
Sequence CGGAACTGCCCGGAGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 85}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060781165_1060781175 -7 Left 1060781165 9:126414389-126414411 CCTGTCTCCTCCGGGCAGTTCCG 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1060781175 9:126414405-126414427 AGTTCCGTGGGCAGGGGGAAGGG No data
1060781165_1060781179 6 Left 1060781165 9:126414389-126414411 CCTGTCTCCTCCGGGCAGTTCCG 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1060781179 9:126414418-126414440 GGGGGAAGGGGAGGATAGCTTGG No data
1060781165_1060781182 29 Left 1060781165 9:126414389-126414411 CCTGTCTCCTCCGGGCAGTTCCG 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1060781182 9:126414441-126414463 TAACACTCCCCGAGGATTTAGGG No data
1060781165_1060781174 -8 Left 1060781165 9:126414389-126414411 CCTGTCTCCTCCGGGCAGTTCCG 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1060781174 9:126414404-126414426 CAGTTCCGTGGGCAGGGGGAAGG No data
1060781165_1060781181 28 Left 1060781165 9:126414389-126414411 CCTGTCTCCTCCGGGCAGTTCCG 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1060781181 9:126414440-126414462 GTAACACTCCCCGAGGATTTAGG No data
1060781165_1060781178 -3 Left 1060781165 9:126414389-126414411 CCTGTCTCCTCCGGGCAGTTCCG 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1060781178 9:126414409-126414431 CCGTGGGCAGGGGGAAGGGGAGG No data
1060781165_1060781176 -6 Left 1060781165 9:126414389-126414411 CCTGTCTCCTCCGGGCAGTTCCG 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1060781176 9:126414406-126414428 GTTCCGTGGGCAGGGGGAAGGGG No data
1060781165_1060781180 21 Left 1060781165 9:126414389-126414411 CCTGTCTCCTCCGGGCAGTTCCG 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1060781180 9:126414433-126414455 TAGCTTGGTAACACTCCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060781165 Original CRISPR CGGAACTGCCCGGAGGAGAC AGG (reversed) Intronic
907257460 1:53190708-53190730 GGGAAGTGCCCTGAGGTGACAGG + Intergenic
913448299 1:118973249-118973271 CTGAACTGCAGGGAGGAGTCAGG - Intronic
921177309 1:212606813-212606835 CGGAGCAGCCCGGCGGACACCGG - Intronic
922567147 1:226608178-226608200 CAGACCTGCCCAGAGGAGAGGGG + Exonic
923400748 1:233614013-233614035 CGGCGCTGCCCGGAGGAGCGGGG + Exonic
1070684960 10:78473304-78473326 CGGACCTGTCAGGAGAAGACAGG + Intergenic
1072450859 10:95538450-95538472 CAGCACTGCCCTCAGGAGACGGG + Intronic
1073185679 10:101613851-101613873 CAGAACTTCCCTGAGGAGGCTGG - Intronic
1073976871 10:109112090-109112112 GGGAACTGGTGGGAGGAGACTGG + Intergenic
1077355756 11:2116000-2116022 GGGAACTGCCTGGAAGACACAGG + Intergenic
1079695568 11:23478031-23478053 GGAAACTGCCCTGAGGAGGCTGG + Intergenic
1081671770 11:44946499-44946521 CGGAACTGGCCGGGAGAGGCAGG + Intronic
1084405350 11:68968843-68968865 CGGAAATTCCCGGAAGACACAGG - Intergenic
1084405665 11:68971424-68971446 GGGGACTTCCCGGAGGAGGCAGG - Intergenic
1086464365 11:87038019-87038041 AGGAACAGCGCGGAGAAGACAGG - Exonic
1089679677 11:120112259-120112281 CGGAACTGCCCCCAAGAGGCTGG + Exonic
1090351577 11:126111567-126111589 CGGGACTGCTTGGAGGAGAGAGG - Intergenic
1090405502 11:126473697-126473719 AGGACCTGCCAGGAGGGGACAGG + Intronic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1098594450 12:72255631-72255653 AGGAACTGCCCGGAACAGCCCGG - Intronic
1100844719 12:98645779-98645801 CGGCACTGCCGGGACAAGACTGG - Exonic
1102964214 12:117113602-117113624 GGGACCTGCCCCCAGGAGACAGG - Intergenic
1103979551 12:124727569-124727591 CGGAGCTGCTGGGAGGACACAGG - Intergenic
1114181015 14:20367903-20367925 CAGAACTACCCAGAGGAGGCCGG - Exonic
1120003257 14:79327596-79327618 CTGAACTGCACTGAGGAGAAGGG - Intronic
1121105721 14:91278193-91278215 TGGAGCTGCTCGGAGGAGCCTGG + Exonic
1131257497 15:90871845-90871867 TGGAGCTGCCGGGAGCAGACAGG + Intronic
1131961218 15:97792129-97792151 CGGAACAGCCCGGGAGAGCCTGG - Intergenic
1134051539 16:11141140-11141162 CGGAAAAGCCTGGAGGAGCCAGG - Intronic
1135470434 16:22724584-22724606 CGGAACTGCGTGGAGGAACCTGG - Intergenic
1136003721 16:27314340-27314362 CGCCACTGCCCGGAGAAGAGGGG - Intronic
1138602231 16:58062946-58062968 GGGAAGTGCCGGCAGGAGACTGG + Intergenic
1141420981 16:83915370-83915392 CGCTACTTCCTGGAGGAGACGGG + Exonic
1148770822 17:50064901-50064923 GGGAACTGCAAGGAGGAGAAAGG + Intronic
1152741589 17:82020765-82020787 CGGCACTGCTCTGAGGAGATGGG + Intronic
1153489172 18:5630196-5630218 CGGGTCCGCCCGGAGGCGACAGG - Intronic
1161373536 19:3927249-3927271 TCAGACTGCCCGGAGGAGACAGG + Exonic
1163509143 19:17725100-17725122 GGGCCCTGCCTGGAGGAGACGGG + Exonic
1164826511 19:31288461-31288483 AGGAAATGGCAGGAGGAGACAGG + Intronic
1165721444 19:38082281-38082303 AGGATCTGCCCGGAGGAGCTCGG - Exonic
1166424082 19:42660811-42660833 CAGAACTGACTGGTGGAGACAGG - Intronic
927714477 2:25342713-25342735 CGGGACGGCCAGGAGGAGCCTGG - Intergenic
929597593 2:43186138-43186160 CAGAACTGCCGGAGGGAGACAGG - Intergenic
934665244 2:96164835-96164857 CGGGCCTGCCCCCAGGAGACCGG + Intergenic
945525057 2:210878080-210878102 AGGAACTGTCCGGAAGAGCCTGG - Intergenic
1174386622 20:50191355-50191377 TGGTGCTGCCCGGAGGAGGCGGG - Exonic
1175242506 20:57560213-57560235 CAGAACTCCCTGGAGGACACAGG + Intergenic
1175358662 20:58389680-58389702 CAGAACTGCCCGGAGTGGCCGGG + Intronic
1176896336 21:14383172-14383194 CGGGACTGCCGGGAGGAGTGGGG - Exonic
1180206927 21:46266469-46266491 CAGAACTGGAAGGAGGAGACAGG + Intronic
1182006991 22:26969147-26969169 CGGAAGGGCCAGGAGGAGATGGG + Intergenic
1182043310 22:27255109-27255131 AGAAACTGCCAGAAGGAGACTGG + Intergenic
1183529811 22:38347297-38347319 CGGCACTCCCAGGAGGTGACAGG + Intronic
1183686434 22:39363701-39363723 GGGGACTGCCTGGAGGAGGCTGG + Intronic
952644521 3:35639446-35639468 CGGAGCTGCGGGGAGGAGCCGGG + Intronic
953700670 3:45193241-45193263 TGGGCCTGCCCGGAGAAGACAGG - Intergenic
956080430 3:65550515-65550537 AAGAGCTGCCCGGAGGTGACAGG - Intronic
966854233 3:184183415-184183437 CGGGACTTCCCAGAGGAGAGCGG + Intronic
969621246 4:8280019-8280041 CGGGGCTGCCTGGAGGAGGCAGG + Intronic
969943051 4:10754058-10754080 CAGAATTGCCAGGAGGAAACAGG - Intergenic
971261072 4:25057472-25057494 AGGAACTGCCTTGAGGAGACAGG - Intergenic
974975054 4:68881243-68881265 GGGAACTGCAGGGAGGAGAAGGG - Intergenic
982707176 4:158723160-158723182 CGGAAAAGCCCCGAGGAGGCGGG - Intronic
983926889 4:173412296-173412318 CGGAACTACTCAGAAGAGACGGG - Intergenic
995881406 5:116848252-116848274 CGGGACTGACTGGAGGAGACAGG - Intergenic
997470126 5:134113093-134113115 CGGCCCTGCCCGGAGGGGAGAGG - Intergenic
1002962155 6:1925723-1925745 GGGAAGTGCCGGGAGGAGAAGGG + Intronic
1005561971 6:27049975-27049997 AGGAAGTGCTGGGAGGAGACGGG + Intergenic
1007776737 6:44228223-44228245 GGGAACTGCCCACAGGAGAGCGG - Intronic
1009705192 6:67240327-67240349 GGAAAATGCCCGGAGGACACAGG + Intergenic
1013492723 6:110664947-110664969 AGGAAATCCCAGGAGGAGACAGG + Intronic
1019708849 7:2509347-2509369 CCAAACGGCCCGGAGGAGGCCGG + Intergenic
1028505495 7:91566016-91566038 AGGCTCTGCCAGGAGGAGACAGG + Intergenic
1029834813 7:103297706-103297728 CTGAACTGGCCGGGGGTGACTGG + Intronic
1032071664 7:128811514-128811536 CGGCACTGCTCCAAGGAGACAGG + Intronic
1034393748 7:150804511-150804533 TGGAACTGCTCAAAGGAGACAGG + Intronic
1039885126 8:41650146-41650168 CGGAACTGCTGGGCGGACACGGG - Intronic
1046819762 8:118622042-118622064 CGGCACTCCGCGGAGGAGTCGGG - Intergenic
1047324094 8:123819671-123819693 GGGAACTACCCTGAGAAGACCGG + Intergenic
1049194507 8:141308095-141308117 CGGCCCCGGCCGGAGGAGACAGG - Intronic
1055868271 9:80842093-80842115 GGGAAATGGCAGGAGGAGACAGG - Intergenic
1056825515 9:89873963-89873985 CAGCACTGCCCCGAGGAGTCAGG - Intergenic
1057230351 9:93317883-93317905 CGGAACCGCCCGGAGAAACCAGG + Exonic
1060781165 9:126414389-126414411 CGGAACTGCCCGGAGGAGACAGG - Intronic
1062268046 9:135696305-135696327 TGGAAGTCCCAGGAGGAGACAGG + Intronic
1185610756 X:1392581-1392603 CGGAGCTGCCCGGAGGTCAAGGG - Exonic
1189856981 X:45233400-45233422 GGGAACTGCTGGGAGGTGACTGG + Intergenic
1199097164 X:143757320-143757342 CGGGAGTGCCCGGATGAGATAGG - Intergenic
1199971599 X:152865805-152865827 CAGAACTGCCTGGAGGAGAGTGG - Exonic