ID: 1060782529

View in Genome Browser
Species Human (GRCh38)
Location 9:126423402-126423424
Sequence CTCATCAAAGCTGCGGGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060782529_1060782536 22 Left 1060782529 9:126423402-126423424 CCTCGCCCCGCAGCTTTGATGAG 0: 1
1: 0
2: 0
3: 3
4: 94
Right 1060782536 9:126423447-126423469 CTGTTAGTTTAGCAATACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060782529 Original CRISPR CTCATCAAAGCTGCGGGGCG AGG (reversed) Intronic
900728521 1:4235405-4235427 CCCAGCAAAGCTGTGGGGCATGG + Intergenic
901493933 1:9610695-9610717 CTCATCGGAGCTGCTGGGCGTGG - Exonic
902809504 1:18880171-18880193 CCCAGCAAAGCTGCGGGGAAGGG + Intronic
903178989 1:21596106-21596128 CCCATCAGAGCTGCTGGGCCTGG - Intergenic
903731501 1:25499418-25499440 CTAATAAAAGCTGCGGGTCTAGG + Exonic
905889574 1:41510855-41510877 CTCCTCAGAGCTGGAGGGCGGGG - Exonic
923105720 1:230851817-230851839 CTGATCAAAGCTGCGTTGCATGG + Intronic
1063211658 10:3886378-3886400 CTCTTCAGATCCGCGGGGCGGGG - Intergenic
1069020460 10:63481891-63481913 CTCTTCAAAGCTGCATGGAGAGG + Intergenic
1069725445 10:70574648-70574670 CTCATCAAATGGGCTGGGCGCGG - Intergenic
1073196790 10:101697769-101697791 ATCATTAAAGCGGCCGGGCGCGG + Intergenic
1076031999 10:127167506-127167528 TTCATAAAAGTTTCGGGGCGGGG - Intronic
1076770093 10:132658072-132658094 CACATCACAGCAGCGGGGAGCGG - Intronic
1077015541 11:397526-397548 GTCATCAAAACTGCGGAGCCAGG - Exonic
1079511542 11:21216481-21216503 CTCATGAAAGCAGCTGGGAGAGG + Intronic
1081966678 11:47174308-47174330 CTCCTCAAAGGGGTGGGGCGGGG + Intronic
1082190306 11:49235000-49235022 CTCATTAAAGCTGGGTAGCGGGG - Intergenic
1083475184 11:62910664-62910686 ATCATCAGAGCTGCCCGGCGGGG + Exonic
1083808577 11:65089389-65089411 CTCAGAAAAGTTGAGGGGCGTGG + Intronic
1088997954 11:115019806-115019828 CTCACCAAAGCTCTGGGGAGGGG - Intergenic
1089153913 11:116386018-116386040 CTGATGAAAGCTGTGAGGCGGGG - Intergenic
1089692753 11:120197126-120197148 CTCTTCAAAGCTGTGGGCCTTGG - Intergenic
1091507101 12:1082780-1082802 TTCATCAAAACAGCCGGGCGTGG - Intronic
1095399032 12:41793388-41793410 CTCATCAAGCCGGCTGGGCGTGG + Intergenic
1101436189 12:104666785-104666807 CTCATCAGAGAGGCGGGGCAAGG + Intronic
1102256506 12:111418492-111418514 CTCCTCAGAGCTGCGGGCCTTGG - Exonic
1104112255 12:125715167-125715189 CTCATAAAAGCTTCTGGGCTTGG - Intergenic
1107871265 13:44748826-44748848 CTGATCAAAGTTGCGTGGGGAGG + Intergenic
1115368830 14:32589206-32589228 CTCATCAAGGCTGAGGGAGGTGG - Intronic
1116784169 14:49269147-49269169 CTCATGAAAGCAGCTGGGAGTGG + Intergenic
1117298073 14:54396971-54396993 GTGAGCTAAGCTGCGGGGCGCGG + Exonic
1118460713 14:65984427-65984449 CTCAGCACAGCTCCGGGGAGAGG + Intronic
1120586002 14:86312839-86312861 CTCTTCAAAGCTGAGGGACAGGG - Intergenic
1122829171 14:104387410-104387432 CTCACCAAAGCCGAGGGGCTGGG - Intergenic
1132621094 16:868642-868664 CTCAACAAAGCTGTGAGCCGGGG + Intronic
1133884065 16:9809769-9809791 CTCATAAAAGCTGCTGGGGCCGG + Intronic
1135144000 16:19945803-19945825 CTCATGAAAGCTGAGGGTAGAGG + Intergenic
1136908871 16:34129646-34129668 CTCTTCAAAGCTGTGGGACAAGG + Intergenic
1138525232 16:57601389-57601411 CTCAACAGAGCTGAGGGGTGAGG - Intergenic
1138553891 16:57761259-57761281 CTCATCTAAACTGCGGAGGGTGG - Intronic
1139836289 16:69841318-69841340 CTCATCTAAGTTGCGGGGTCAGG + Intronic
1140039909 16:71399622-71399644 TTAACCACAGCTGCGGGGCGCGG - Intergenic
1141125089 16:81395448-81395470 CCCAGCAAAGCTGTGGGGCAGGG + Intergenic
1142413151 16:89926243-89926265 CTCCTCGCGGCTGCGGGGCGGGG + Intronic
1143544867 17:7589958-7589980 CTGATCGCAGCTGCGGGTCGGGG - Exonic
1143861763 17:9896611-9896633 CTCCTCAAAGCTCCAGGGCCTGG - Exonic
1144399619 17:14883695-14883717 CTCATGAAAGCAGCTGGGAGTGG - Intergenic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1147033241 17:37658844-37658866 TGCATCAAAGCTGCTGGGCGTGG - Intergenic
1150170956 17:62993887-62993909 CTCATCCAGGCTGCAGTGCGTGG - Intergenic
1157125209 18:44950239-44950261 CTCAGCAGAGCTGCTGGGTGGGG - Exonic
1161283669 19:3458363-3458385 CTAATAAAAGCTGCGGTGGGAGG + Intronic
1161300254 19:3539056-3539078 CTCCTCCCAGCTGCGGGGTGAGG - Intronic
1163064314 19:14781984-14782006 ATAATCAAGGCTGCCGGGCGCGG + Intergenic
1163971260 19:20797494-20797516 CTCATAAAATCGGCCGGGCGCGG - Intronic
1165642083 19:37398329-37398351 CTCAGCAAAGCTGTGGGGGTGGG - Intergenic
928928003 2:36597975-36597997 CTCCTCCAAGCTGCAGGCCGGGG + Exonic
933146539 2:78860612-78860634 GTCAACAAAACGGCGGGGCGCGG - Intergenic
933326374 2:80843454-80843476 AGAATCAAAGCTGCCGGGCGCGG + Intergenic
943669869 2:190649094-190649116 CTCCTCCAGGCTGCGGCGCGCGG - Intronic
1168755077 20:310586-310608 CTCCCCAGAGCTGGGGGGCGGGG - Intergenic
1171814119 20:29768311-29768333 CTCTTCAAAGCTGTGGGACAGGG - Intergenic
1171904341 20:30888399-30888421 CTCTTCAAAGCTGTGGGACAAGG + Intergenic
1172033292 20:31996021-31996043 CTGAGCAGAGCTGAGGGGCGGGG - Intronic
1175797333 20:61780114-61780136 CTCATGAAACCTGTGGGGCAAGG - Intronic
1180337763 22:11594539-11594561 CTCTTCAAAGCTGTGGGACAAGG + Intergenic
1182567750 22:31212548-31212570 CTCAGAAAAGCTGGGAGGCGGGG + Intronic
1184904510 22:47471924-47471946 CCCAGCAAAGCTGTGGGGTGGGG - Intronic
1185179876 22:49353110-49353132 CGCATCAAACCCGCGGGGAGAGG + Intergenic
952671502 3:35974566-35974588 CTCATGAAAGCAGCTGGGAGGGG - Intergenic
964743223 3:159988717-159988739 CGCTGCACAGCTGCGGGGCGGGG + Intergenic
971948729 4:33315647-33315669 CTCATGAAAGCAGCTGGGAGGGG + Intergenic
972333133 4:38081718-38081740 CACAACAAAGCTGTGGGGGGTGG + Intronic
982534338 4:156589998-156590020 CTCAATAAAGCTGTGGGGTGAGG + Intergenic
984026374 4:174547896-174547918 CTCATGAAAGCAGCTGGGGGAGG + Intergenic
985779800 5:1864463-1864485 CTCATCCATGCTGTGGGGAGGGG + Intergenic
987020943 5:13870490-13870512 CTCACCAAAGAAGAGGGGCGAGG - Intronic
993777047 5:92012498-92012520 CTCATGAAAGCAGCTGGGTGGGG + Intergenic
996848925 5:127931384-127931406 CTAATTAAAGCAGCGGGGCTGGG + Intergenic
1000738398 5:164933977-164933999 CTCATCATAGCTGCCAGGCAGGG + Intergenic
1002071335 5:176680399-176680421 CTCAGCCGAGCTGCAGGGCGAGG + Intergenic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1016520541 6:144941885-144941907 CTCATAAGAGCTGCAGGGCGTGG + Intergenic
1017838448 6:158201765-158201787 CACATTAAATCTGCCGGGCGCGG + Intergenic
1019681808 7:2354785-2354807 CGCACCAAGGCCGCGGGGCGGGG - Intronic
1021793382 7:24228309-24228331 CTCATCAAAGCTTTGGGGGTAGG - Intergenic
1026395907 7:69954031-69954053 CTCAGTAAAGCTACGGGGTGGGG - Intronic
1030347603 7:108452395-108452417 CTCATTAATGCTGTGGGGGGGGG + Intronic
1031170945 7:118291208-118291230 CTCATGAAAGCAGCTGGGAGGGG + Intergenic
1034363572 7:150524155-150524177 CTCAGCAAAGCTGTGGGGACAGG - Intergenic
1038122884 8:24638095-24638117 CTCATAAAAGCTGCTGAGGGTGG - Intergenic
1046598564 8:116290038-116290060 CTCATCACAGCTGTGGAGTGGGG + Intergenic
1050700140 9:8329563-8329585 CTCATCAGAGCTGCCAGGTGGGG + Intronic
1058453154 9:105115595-105115617 CTCAGCAAAGAGGCTGGGCGTGG + Intergenic
1060782529 9:126423402-126423424 CTCATCAAAGCTGCGGGGCGAGG - Intronic
1203365800 Un_KI270442v1:254628-254650 CTCTTCAAAGCTGTGGGACAGGG - Intergenic
1198323665 X:135544780-135544802 CTGTTCATAGCTGCTGGGCGTGG + Intronic
1201146796 Y:11069158-11069180 GGCAGCAAAGCTGAGGGGCGAGG - Intergenic