ID: 1060784129

View in Genome Browser
Species Human (GRCh38)
Location 9:126435755-126435777
Sequence GCCTCTGGGTGCCGCCGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 253}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060784129_1060784138 12 Left 1060784129 9:126435755-126435777 CCAGGCCGGCGGCACCCAGAGGC 0: 1
1: 0
2: 1
3: 12
4: 253
Right 1060784138 9:126435790-126435812 GGGGCACACCGTCTTTTCTCAGG No data
1060784129_1060784136 -7 Left 1060784129 9:126435755-126435777 CCAGGCCGGCGGCACCCAGAGGC 0: 1
1: 0
2: 1
3: 12
4: 253
Right 1060784136 9:126435771-126435793 CAGAGGCTCGAAGGCCACAGGGG No data
1060784129_1060784133 -9 Left 1060784129 9:126435755-126435777 CCAGGCCGGCGGCACCCAGAGGC 0: 1
1: 0
2: 1
3: 12
4: 253
Right 1060784133 9:126435769-126435791 CCCAGAGGCTCGAAGGCCACAGG No data
1060784129_1060784139 13 Left 1060784129 9:126435755-126435777 CCAGGCCGGCGGCACCCAGAGGC 0: 1
1: 0
2: 1
3: 12
4: 253
Right 1060784139 9:126435791-126435813 GGGCACACCGTCTTTTCTCAGGG No data
1060784129_1060784140 17 Left 1060784129 9:126435755-126435777 CCAGGCCGGCGGCACCCAGAGGC 0: 1
1: 0
2: 1
3: 12
4: 253
Right 1060784140 9:126435795-126435817 ACACCGTCTTTTCTCAGGGTTGG No data
1060784129_1060784135 -8 Left 1060784129 9:126435755-126435777 CCAGGCCGGCGGCACCCAGAGGC 0: 1
1: 0
2: 1
3: 12
4: 253
Right 1060784135 9:126435770-126435792 CCAGAGGCTCGAAGGCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060784129 Original CRISPR GCCTCTGGGTGCCGCCGGCC TGG (reversed) Intronic
900100638 1:960714-960736 GGCTCTGCGTCCTGCCGGCCGGG - Exonic
900610636 1:3543168-3543190 GCCTCAGGGTGCCCCGGCCCTGG - Intronic
901242664 1:7704316-7704338 GGCTCCGGGGGCCGTCGGCCCGG + Intronic
902674572 1:17999764-17999786 GCCTGTGGATGCTGCAGGCCAGG + Intergenic
903233751 1:21936983-21937005 GCCGCAGGGTGGCGCCGGCCCGG + Intronic
903322845 1:22553063-22553085 GCCTCTGGGTGGCGGGGGCAAGG - Intergenic
905734089 1:40314455-40314477 GCCTTTGGGAGCGGCCTGCCAGG - Intronic
910251096 1:85200574-85200596 GCCGGTGGGTGCAGCCGCCCGGG + Exonic
910936405 1:92486592-92486614 GGCCCGCGGTGCCGCCGGCCTGG + Intronic
912203019 1:107480030-107480052 CCATCTGGCTGCCGCCTGCCTGG + Intronic
915133762 1:153714957-153714979 GCCTCTGGGTGGCGGGGGGCGGG + Intergenic
915350037 1:155218557-155218579 GCCTTTGGGTGCCCATGGCCTGG + Intergenic
915353434 1:155240795-155240817 GCCTTTGGGTGCCCATGGCCCGG + Intronic
916756160 1:167772006-167772028 GCCTCGGGCTGCCGACTGCCTGG - Intronic
916890375 1:169107058-169107080 GCTGCTGGGTCGCGCCGGCCTGG + Intronic
920528392 1:206685025-206685047 GCCGCTGGCTCCCACCGGCCCGG - Exonic
920655215 1:207869210-207869232 GCCGCTGGGTGGCGCCGCGCGGG - Intergenic
923007918 1:230067081-230067103 GCCGCGCGGCGCCGCCGGCCCGG + Intronic
1063240354 10:4163075-4163097 GCCTCAGGGTGCTGCAGGCTGGG + Intergenic
1064254505 10:13732576-13732598 GCCTCTGTCTGCCGCCGGGCAGG + Intronic
1065727104 10:28677343-28677365 GCCGCTCGGAGCCGCCGGGCAGG + Exonic
1071997486 10:91162731-91162753 GCCTCTCGCCGCCGCCCGCCAGG - Intergenic
1073137269 10:101227059-101227081 GCCGCTGGTGGCGGCCGGCCCGG + Exonic
1073251110 10:102120754-102120776 TCCTCCGGGTGCCGCCGGATGGG + Intergenic
1073328320 10:102655331-102655353 CCCTCTGGGTGCCACCAGCCTGG - Intronic
1074534114 10:114316265-114316287 GCCTCTGATGGCCGCTGGCCTGG + Intronic
1075375434 10:121974841-121974863 GCCTCCGGGCGGCGCGGGCCCGG - Intronic
1076318721 10:129563254-129563276 GCCTCTGCATCCCGCAGGCCTGG - Intronic
1076373782 10:129970652-129970674 GGCGATGGGTGCCGGCGGCCGGG + Intergenic
1076844214 10:133061027-133061049 GCCTATGGGTGGCCCCCGCCGGG - Intergenic
1076874998 10:133211469-133211491 GCCTCTGCGTCCTGCAGGCCTGG + Exonic
1076902667 10:133347627-133347649 GCCTCTTGGTTCCCCTGGCCTGG + Intronic
1077489168 11:2852650-2852672 GCCTCTGAGTGCAGACAGCCGGG + Intergenic
1077491368 11:2862415-2862437 GCCGCTAGGGGCCGCGGGCCTGG + Intergenic
1077524787 11:3057500-3057522 GGCTCCGGATGTCGCCGGCCCGG + Intronic
1078417785 11:11180146-11180168 GCCTCTGGCTGCCTCGGGCAGGG - Intergenic
1079133858 11:17765003-17765025 GCCTCTGGGGGCCTGGGGCCTGG + Intronic
1079451901 11:20605162-20605184 GCGTTTGGGTGCCGCGGGGCCGG + Intronic
1081658206 11:44871671-44871693 GCTTCTGGGACCCGCCTGCCAGG - Intronic
1081854642 11:46295764-46295786 GGATCCGGGTGCCGCCGTCCTGG - Intronic
1082784896 11:57311391-57311413 GCTGCTGGGTGCGGCCAGCCGGG + Intronic
1082784948 11:57311616-57311638 GCCTCTGGGGGCTGCGGGGCGGG - Intronic
1083162966 11:60867127-60867149 ACCACTGGGAGCTGCCGGCCTGG - Intergenic
1083636204 11:64122358-64122380 GGCTCTGGGTGACGCTGGCAGGG + Intronic
1084973919 11:72786054-72786076 CCCTCAGGGTGCAGCAGGCCGGG + Intronic
1085719870 11:78903323-78903345 GCTCCTGGGCGCCGCCGGCAGGG + Exonic
1088541835 11:110921135-110921157 GTCTTTGGGTGCCGCCAGCTAGG - Intergenic
1091752709 12:3032706-3032728 CCCTCTGAGTGCCAGCGGCCTGG + Intronic
1093583168 12:20807313-20807335 GCCTCTGGGTGAAGCCAGCTGGG - Intergenic
1096572266 12:52530427-52530449 ACCTCTGGGTGCAGCAGGCATGG - Intergenic
1097192198 12:57224956-57224978 GGCTCTGGGAGCTGCTGGCCGGG - Exonic
1097872269 12:64611009-64611031 GCCTCGGGCTGCCGCCTGCGGGG + Intronic
1104688646 12:130807505-130807527 GGCTCTGGGGTCCGCCTGCCTGG - Intronic
1104688661 12:130807562-130807584 GGCTCTGGGGTCCGCCTGCCTGG - Intronic
1104701012 12:130904791-130904813 GGCTCTGGGAGCCGGCCGCCTGG + Intergenic
1104701027 12:130904833-130904855 GGCTCTGGGAGCCGGCCGCCTGG + Intergenic
1104701072 12:130904959-130904981 GGCTCTGGGAGCCGGCCGCCTGG + Intergenic
1104701100 12:130905043-130905065 GGCTCTGGGAGCCGGCCGCCTGG + Intergenic
1104701128 12:130905127-130905149 GGCTCTGGGAGCCGGCCGCCTGG + Intergenic
1104701154 12:130905211-130905233 GGCTCTGGGAGCCGGCCGCCTGG + Intergenic
1104769541 12:131352486-131352508 GCCTCTGGTTCCAGCAGGCCCGG - Intergenic
1104910767 12:132239933-132239955 GCCTCAGGCAGCCGCCTGCCTGG + Intronic
1104968836 12:132522073-132522095 GTCTCTGTGTGCAGCCGGCGCGG + Intronic
1106241899 13:27919883-27919905 GCCTCTTAGTGCGGCCAGCCAGG + Intergenic
1109854311 13:68107980-68108002 GCCGGTGGGCACCGCCGGCCCGG - Intergenic
1112771575 13:102799594-102799616 GCACCTGGGCGCCGCCAGCCCGG + Intronic
1115398213 14:32933211-32933233 CCCTCTGGGTCCCGGCGGGCCGG + Intergenic
1117776478 14:59189180-59189202 CCCTCTCGGAGCCGCCGGGCCGG - Intronic
1119087936 14:71754131-71754153 GCCGCTGGGGGCCTCCGGCAGGG + Intergenic
1122542744 14:102507151-102507173 CCCCGTGGGTGCCGCCGGCTCGG - Exonic
1122769954 14:104093491-104093513 TCCTCTGGTTGCGGCTGGCCGGG - Exonic
1122922418 14:104885509-104885531 GCCACTGGGTGCGGCCCCCCAGG + Exonic
1124629089 15:31327019-31327041 GCGTCTGCGAGGCGCCGGCCCGG - Exonic
1128721671 15:69954941-69954963 GCCTCTGGATGCAGCCAGCCTGG - Intergenic
1131144532 15:90002328-90002350 GCGTCGGGGCGCCGCGGGCCGGG + Intronic
1131432747 15:92399963-92399985 GCCTCTGTCTGTAGCCGGCCTGG + Intronic
1132101187 15:99024544-99024566 TCCTCTGGATGCCGCCTTCCTGG + Intergenic
1132512688 16:352304-352326 GCTTCCGGGTCCCGCCCGCCCGG + Intronic
1132519565 16:381189-381211 GCCGCTTCCTGCCGCCGGCCCGG - Intronic
1132645707 16:998403-998425 GGCTCTGGGCGCCACCTGCCTGG - Intergenic
1132671037 16:1102465-1102487 GCCTGGGGGTGCCGGGGGCCAGG - Intergenic
1132675362 16:1119163-1119185 GTCTCTGGGTGCCGCTGACCAGG + Intergenic
1132750883 16:1457109-1457131 GGCTCTGGGAGCCACCCGCCAGG + Intronic
1133111485 16:3550526-3550548 GCCTCTGGGAGCTGCCAGGCAGG + Intronic
1133321242 16:4914950-4914972 GCCTCTAGGTGCAGCTGGCCTGG - Intronic
1135517754 16:23149484-23149506 GCCTCCCGGCGCCGCCCGCCCGG + Intergenic
1137531750 16:49282375-49282397 GGCTCAGGGTCCCGGCGGCCGGG + Intergenic
1138425899 16:56931939-56931961 GCCTCTGGGTGACGCAGACGCGG + Intergenic
1139489504 16:67279012-67279034 GTCTCTGGGTGCCCGCGGCGAGG + Exonic
1139658263 16:68402311-68402333 GCATCTGGGTGCTGAGGGCCAGG + Intronic
1141582753 16:85011434-85011456 TCCCCTGGGTCCCGCCGGGCAGG + Exonic
1142125848 16:88409900-88409922 GGCTCTGGGTGGGGCGGGCCTGG + Intergenic
1142147620 16:88499120-88499142 GCCCCAGGGTGCCGGCAGCCTGG - Intronic
1142212229 16:88813612-88813634 GCCTCTGGAGGAGGCCGGCCGGG + Intergenic
1142280074 16:89143394-89143416 GTCTCTGGGTGGTGCAGGCCAGG + Intronic
1142308852 16:89300406-89300428 GCCCCTGGGAGCCTCTGGCCAGG - Intronic
1142697066 17:1639638-1639660 GTCTCTGGGTCCTGCCAGCCAGG - Exonic
1144724942 17:17496997-17497019 GCCTCCCCGAGCCGCCGGCCGGG - Intergenic
1145013431 17:19382368-19382390 GCGTCTGGGGGCGGCAGGCCAGG - Exonic
1146652737 17:34616527-34616549 GCCTCTGGGTGACTGCAGCCTGG - Intronic
1146844969 17:36176670-36176692 GACTCTGGGTGCTGCTGACCCGG - Intronic
1146863340 17:36323770-36323792 GACTCTGGGTGCTGCTGACCCGG + Intronic
1146880544 17:36439601-36439623 GACTCTGGGTGCTGCTGACCCGG - Intergenic
1147993527 17:44349452-44349474 GCATCTGGGTGGCCCCTGCCAGG + Exonic
1148212775 17:45818241-45818263 GCTGCTGGGTGGGGCCGGCCAGG + Intronic
1148451098 17:47778319-47778341 GGCTCTCGGTGCAGCAGGCCGGG + Intergenic
1148816073 17:50329145-50329167 GGCTCTGGGTGCCCCCAGCATGG - Intergenic
1150259212 17:63774493-63774515 GCCTCGGGGCACCGGCGGCCGGG + Intronic
1151406305 17:73889116-73889138 GCCTCTGGGTGTGGCCTGGCTGG - Intergenic
1151697504 17:75725033-75725055 TCCTCTGGGTGCCTCAGTCCTGG - Intronic
1151723756 17:75873204-75873226 GCCTCAGGGCGCCCCAGGCCTGG + Intergenic
1151875237 17:76864255-76864277 GCCCCTGGGTCCTGCTGGCCTGG - Intergenic
1152426794 17:80222443-80222465 GCCTCAGGGTGCAGACAGCCAGG - Intronic
1152584632 17:81183498-81183520 GCCCCTGGGTGCCCCCGGCAGGG + Intergenic
1152597870 17:81246633-81246655 GCCTCTGGGCACCGCTGCCCCGG + Exonic
1152739842 17:82014076-82014098 GCCTCTGGGGACCGTCTGCCAGG + Intronic
1152928877 17:83100048-83100070 GCCACTGTGTGCTGCCAGCCGGG + Intergenic
1155166435 18:23236017-23236039 TCCCCTGGGTGCCGCTTGCCCGG - Exonic
1156460504 18:37319015-37319037 GCCTCTGGCTGCCCCCGCCTGGG + Intronic
1157492805 18:48136186-48136208 TCCAGTGGGTGACGCCGGCCCGG + Intronic
1158282984 18:55848339-55848361 GCATTTGGGTGCCGCGGACCAGG + Intergenic
1158399828 18:57111875-57111897 GCCTGTGGCTGCCGCCAGTCTGG + Intergenic
1160568451 18:79800722-79800744 GCCTATGGTTGCAGTCGGCCTGG + Intergenic
1160619303 18:80159860-80159882 GCCGCTGGAGGCCGCCGTCCAGG + Exonic
1160888864 19:1366423-1366445 GACTCTGAGAGCGGCCGGCCTGG - Intronic
1160983528 19:1827373-1827395 GCCTCTGCCGGCCGCCGGTCGGG + Exonic
1161777973 19:6274147-6274169 TCCCCTGGGTGCAGCAGGCCGGG - Intronic
1163368497 19:16889234-16889256 GGGTCTGGGTGCCGCCAGACAGG - Exonic
1163695649 19:18762022-18762044 GCGTGTGGATGCCGCCTGCCTGG - Intronic
1163799496 19:19356061-19356083 GCATCTGGGTCACGTCGGCCAGG + Exonic
1165006214 19:32809422-32809444 GCCTGTGGGTGTCGCCAGCCCGG + Intronic
1167134920 19:47610169-47610191 CCCTCCGGGTGCCCGCGGCCTGG - Intronic
1167263019 19:48469604-48469626 GCTTCTGGGCGCCGCGCGCCAGG - Intronic
1167287910 19:48609168-48609190 GCCTCTGGGACCAGACGGCCTGG - Intronic
1167377710 19:49120338-49120360 GCCTCTGGGTTCTGCCGGCCAGG + Intronic
1168110516 19:54189310-54189332 GCCACTGGGCGCCGCCACCCTGG + Intronic
1168349547 19:55668313-55668335 GCCTCTGTGTGCCACTGCCCAGG + Intronic
926219085 2:10923234-10923256 GGCTCTGGGTGCCGCTGGAGAGG - Intergenic
928022509 2:27715751-27715773 GCCTCTGGGCCCCTCTGGCCGGG - Intergenic
929075083 2:38074318-38074340 GCCTCTGGGAGGCGTGGGCCAGG - Intronic
931299164 2:60959749-60959771 TGTTCTGGGTGCCGCTGGCCTGG - Intronic
932567740 2:72920164-72920186 GCCTCCGGGCGCCGAGGGCCGGG + Intronic
932759455 2:74429946-74429968 GCCTCTTGGGGCCGCCAGTCAGG + Exonic
934503834 2:94877286-94877308 GCTTCTGGGTGGGGCCTGCCTGG - Intergenic
934521763 2:95024423-95024445 GCCTCTGTGAGCTGCCAGCCCGG - Intergenic
936290129 2:111216832-111216854 GCCTCTTGGTGCCAGCAGCCAGG - Intergenic
938537220 2:132256716-132256738 CACTCGGGGTGCCGCCGACCTGG + Intronic
939017675 2:136920723-136920745 GCCTCTCGGTGCAGACAGCCTGG - Intronic
948600065 2:239102666-239102688 ACCTGTGGGTGTCGCCTGCCAGG - Intronic
948862735 2:240760770-240760792 GCCTCTGGGGGCAGCAGGTCGGG + Exonic
1168771470 20:419427-419449 GCATCTGGCTGCCCCCGTCCGGG - Exonic
1169195492 20:3680301-3680323 GGCTCTGGGTGCCTGGGGCCTGG - Intronic
1171481632 20:25459555-25459577 CACTCTGGCTGCCGCCGCCCAGG + Intronic
1171866123 20:30488495-30488517 CACTCGGGGTGCCGCCGACCTGG + Intergenic
1172502104 20:35434644-35434666 GCCTCCGGGGGCCGCTGGCTTGG + Exonic
1173243490 20:41317807-41317829 GCCTCTGGCGGCCGCGGGGCGGG + Intergenic
1173865211 20:46308605-46308627 GCCGCAGGCGGCCGCCGGCCCGG + Intergenic
1175242081 20:57557100-57557122 TCCTCTGGGTCCCCCAGGCCAGG - Intergenic
1175403756 20:58714513-58714535 GCCTGTGGGTTGCTCCGGCCGGG - Intronic
1176022758 20:62970526-62970548 GCTTCTGGGTGCCACCTCCCCGG + Intergenic
1176643113 21:9325031-9325053 GCCTCTGGGTGCCGCACTTCCGG - Intergenic
1180073259 21:45449248-45449270 GCTTCCAGCTGCCGCCGGCCAGG + Intronic
1180312837 22:11253369-11253391 CACTCGGGGTGCCGCCGACCTGG + Intergenic
1180369820 22:11974185-11974207 GCCTCTGGGTGCCGCACTTCCGG + Intergenic
1180876649 22:19178070-19178092 GGCCCTCGGTGCCGCCGCCCTGG + Intronic
1182119885 22:27779754-27779776 GCCCCTGGGTGACCCAGGCCTGG - Intronic
1182401307 22:30080063-30080085 CTCTCTGGGACCCGCCGGCCTGG + Intergenic
1182524189 22:30905655-30905677 GCCACTGGGTTCCGCCGGGTGGG + Intronic
1183343274 22:37293790-37293812 GCCACTGGGTGCCTCCTGCAGGG + Intronic
1183353109 22:37344478-37344500 GCCTCTGGGTGCCCTGAGCCTGG - Intergenic
1183486241 22:38089077-38089099 GCCTGTGAGTGCCCCCGCCCCGG - Exonic
1183656127 22:39185698-39185720 GCCTTTGGCTGCCAGCGGCCGGG + Intergenic
1184264096 22:43337555-43337577 TCCTCTGTGTGCCTCCAGCCTGG + Intronic
1184433905 22:44458529-44458551 GCCCCTGGGTGTAGCCCGCCTGG - Intergenic
1185078943 22:48698758-48698780 GCCTCGGGGTGCAGCCCGTCTGG + Intronic
1185258499 22:49849279-49849301 GGCTCTGGGATCCCCCGGCCTGG - Intergenic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
950376950 3:12580010-12580032 GCCTCTGGGGCCTGCCTGCCAGG - Intronic
950518210 3:13480687-13480709 GTCTCTGGGTGACGACTGCCAGG + Intronic
951016949 3:17742275-17742297 GCCTGAGGGTGCCGCCGCCACGG - Intronic
954387729 3:50253089-50253111 GCCTCCGGATGACGCCGGACAGG - Exonic
954410400 3:50368063-50368085 GCCTCTGGGTTCCTCTGGGCTGG + Intronic
954640051 3:52092442-52092464 GCCTCGGGGTCCAGCCAGCCTGG - Intronic
957096969 3:75785553-75785575 GCCTCTGGGTGCCGCACTTCCGG + Intronic
960513244 3:118575484-118575506 GCCTCTGGGTCATGCCTGCCTGG - Intergenic
961594680 3:128006904-128006926 GCCTCTGGGAGCCGGAGCCCTGG - Intergenic
961615846 3:128180411-128180433 GCCTCTGAATGCTGCCTGCCAGG - Intronic
961785187 3:129343290-129343312 GTGTCTGGGTCCCGCCTGCCAGG + Intergenic
967921685 3:194618939-194618961 GCCTCTGGGCCCAGCGGGCCAGG - Intronic
1202743771 3_GL000221v1_random:79998-80020 GCCTCTGGGTGCCGCACTTCCGG + Intergenic
968509561 4:989417-989439 GGCGTTGGGTGCGGCCGGCCAGG + Exonic
969214591 4:5711604-5711626 GCTTCTGGGTCCTGCGGGCCCGG + Intronic
969622725 4:8286841-8286863 GCCTCTGGGTTCCGGCGTCTGGG - Intronic
969699981 4:8762548-8762570 GCCACAGGGTGCCGCTGCCCAGG + Intergenic
972815556 4:42641091-42641113 GGCTCTGGGTGCAGACTGCCTGG + Intronic
979609001 4:122670314-122670336 GCCTGCCGGTGCCGCCGGACCGG + Intergenic
985726712 5:1520027-1520049 GTCCCTGGGTGCTGCCTGCCTGG - Intronic
985792140 5:1934986-1935008 GCCTCTGGGGGCTGGGGGCCAGG - Intergenic
985844819 5:2336335-2336357 CCCTCTGGGTGCCACCACCCAGG - Intergenic
985861790 5:2477238-2477260 GCCTCCGGGTGCTGCCTGCCTGG + Intergenic
990381869 5:55227149-55227171 GCCTCCGGGTGCCGACTGCTCGG + Exonic
990952405 5:61311239-61311261 GGCCCTGGGGGCTGCCGGCCAGG - Intergenic
992701332 5:79344411-79344433 GCCTCTGGGTTTAGCAGGCCAGG - Intergenic
993647013 5:90474507-90474529 GCCTCTGCTTGCTGCCGACCTGG - Exonic
997240348 5:132301971-132301993 GCCTCTGGCTCCAGCCAGCCCGG + Intronic
999253967 5:150199296-150199318 GCCTCTGCCTGCTGCTGGCCTGG + Exonic
1001776983 5:174336441-174336463 GCCTCTAGGAGCCTCCAGCCTGG + Intergenic
1002134335 5:177098608-177098630 GCAGCTGGTTGCCGCCCGCCTGG + Intergenic
1003948162 6:11094008-11094030 GTCTCTGGGTGCCGCGGCCTCGG + Intergenic
1005847451 6:29792703-29792725 GCCTGTGAGTGACACCGGCCGGG + Intergenic
1006085108 6:31589732-31589754 GCCTCTTGGGGCCTCCAGCCAGG + Intronic
1006877169 6:37307782-37307804 GCCTCTTGGTCCGGCCGGTCAGG + Intronic
1006911545 6:37566546-37566568 GCCCCTGGGTGCAGCCGGGGCGG - Intergenic
1007759958 6:44127803-44127825 ACCCCTGGGTCCCGCGGGCCCGG - Intronic
1008503059 6:52202335-52202357 GATTCTGGGTGAAGCCGGCCAGG + Intergenic
1017774933 6:157673134-157673156 GCCTCTGGTGTCCCCCGGCCTGG - Exonic
1018966661 6:168495344-168495366 GCCACTGGCTGACGCCAGCCAGG + Intronic
1019504219 7:1382769-1382791 GCCCCTGGGCCCCGCCGTCCTGG - Intergenic
1019563982 7:1670698-1670720 GCGTCTGGGGGGCGCCGGGCAGG - Intergenic
1019735165 7:2646861-2646883 GCTCCTGGGGGCCGCCGCCCTGG + Exonic
1019811833 7:3170640-3170662 GCCTCTGGGCTGCTCCGGCCAGG - Intronic
1019920094 7:4157861-4157883 GTCTCTGCCTGCAGCCGGCCAGG + Intronic
1020009135 7:4799008-4799030 GCCTCTGCCTGCCACCGGCACGG - Intronic
1020107888 7:5430614-5430636 GCCTCTGGGAGCCCCCAGCCTGG + Intergenic
1020258515 7:6516629-6516651 GCCTCTGGGTGGCTGCGGGCGGG - Intronic
1020347797 7:7183251-7183273 ACCTGTGGGTCCCGCCGGACTGG + Intronic
1020657077 7:10940582-10940604 GCCTCTGGGAGCCGAGCGCCGGG + Intergenic
1023791845 7:43758842-43758864 GGCTCTGGCGGCCGCGGGCCCGG - Intronic
1025139059 7:56447886-56447908 GCCTCGGGGTGCCGCGTTCCTGG - Intergenic
1026833575 7:73624074-73624096 GCCTCCGGGAGCCGCAGGACCGG + Intronic
1032841957 7:135721442-135721464 GCCTCTGGGAGCTGCAGCCCTGG - Exonic
1033656856 7:143380906-143380928 GCCCCTGTGCGCCTCCGGCCCGG - Intergenic
1034405993 7:150902793-150902815 GCCTCTGGGAGGAGCTGGCCGGG + Intergenic
1034446585 7:151116899-151116921 GAGGCTGGGTGCCGCGGGCCTGG + Intronic
1034841902 7:154405711-154405733 GCCTCTGAGTCCTGCCTGCCGGG - Intronic
1035266807 7:157693669-157693691 GCCTCGGGGAGCTCCCGGCCAGG + Intronic
1035553512 8:546277-546299 GCCTTTGGGAGATGCCGGCCAGG + Intergenic
1035729809 8:1845984-1846006 CCCTCTGGGTGCAGCTGGACTGG + Intronic
1036661380 8:10711235-10711257 GCCCCGGGGTGCCCCTGGCCTGG - Intronic
1039630610 8:39107783-39107805 GCCTCTGGTTGCTGCTGGCCGGG + Exonic
1049361450 8:142214160-142214182 GACGCTGGGTGCGGCCCGCCTGG + Intronic
1049408342 8:142461545-142461567 GCCTCTGTGGGCCTGCGGCCGGG - Intronic
1049435329 8:142583765-142583787 GGACCTGGGTGCAGCCGGCCAGG + Intergenic
1049600011 8:143503373-143503395 GCTTCTGTGTGCTGCCAGCCAGG - Intronic
1049758979 8:144323378-144323400 GCCTCTGGGTGGGGCTGGTCAGG - Intronic
1049951044 9:644427-644449 GGCTCAGGGTTCCGCAGGCCAGG + Intronic
1055757599 9:79572594-79572616 GCGGCTGGGTGCCGGCTGCCGGG - Exonic
1056243304 9:84669989-84670011 GCCGCTGGGTGCCGGTGGCGCGG - Intronic
1056369745 9:85941624-85941646 ACCGCAGGGTCCCGCCGGCCGGG - Intronic
1057441831 9:95089038-95089060 GCCTCGGGGAGCCTCCTGCCTGG - Intergenic
1058851077 9:109012986-109013008 GCTCCCGGGTGCCCCCGGCCGGG - Intronic
1059061304 9:111037907-111037929 GCCGCTGGGTGCGGGAGGCCAGG + Exonic
1060784129 9:126435755-126435777 GCCTCTGGGTGCCGCCGGCCTGG - Intronic
1060794065 9:126503022-126503044 GGCTCTGGCTGGCACCGGCCTGG + Intronic
1060897342 9:127225875-127225897 GCCTAGGGGCGCCGGCGGCCCGG - Intronic
1062037643 9:134389827-134389849 GCCCCTGGGGGCTGCCGGCTAGG + Intronic
1062067778 9:134538003-134538025 GGCTGTGGGGGCAGCCGGCCGGG - Intergenic
1062202182 9:135309412-135309434 GCCTCTGGGTGGGGTCTGCCCGG + Intergenic
1062318957 9:135981224-135981246 GCCCGTGGGTGCCCCCTGCCAGG + Intergenic
1062632200 9:137468210-137468232 GGCCCTGGGTGCCGGCTGCCTGG - Intronic
1203712405 Un_KI270742v1:109962-109984 GCCTCTGGGTGCCGCACTTCCGG + Intergenic
1190267385 X:48835494-48835516 TGCTCTGGGGGCCGCGGGCCGGG - Exonic
1192034115 X:67545255-67545277 GCCTCTGGGTGCCTGGGGCCCGG - Exonic
1194091515 X:89585091-89585113 GCCTCTCGGTGCCTCTGGCTAGG + Intergenic
1195687862 X:107602027-107602049 GCCTCTGGCTGCCTCTGGCTAGG - Exonic
1195688694 X:107606628-107606650 TCTTCTGGGTGCTGCCTGCCAGG + Intergenic
1200057811 X:153470728-153470750 GCCTCTGGGTGGTGCCGGGGCGG - Intronic