ID: 1060785624

View in Genome Browser
Species Human (GRCh38)
Location 9:126449854-126449876
Sequence CACTTCCCATTTTACAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060785621_1060785624 -9 Left 1060785621 9:126449840-126449862 CCTTGAAACCACTCCACTTCCCA 0: 1
1: 0
2: 1
3: 27
4: 255
Right 1060785624 9:126449854-126449876 CACTTCCCATTTTACAAATAAGG No data
1060785620_1060785624 15 Left 1060785620 9:126449816-126449838 CCTTCATATATAAACTCATTTAA 0: 1
1: 0
2: 3
3: 68
4: 554
Right 1060785624 9:126449854-126449876 CACTTCCCATTTTACAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060785624 Original CRISPR CACTTCCCATTTTACAAATA AGG Intronic
No off target data available for this crispr