ID: 1060788862

View in Genome Browser
Species Human (GRCh38)
Location 9:126472068-126472090
Sequence CTCAATACACAGCAGGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 172}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060788862_1060788878 29 Left 1060788862 9:126472068-126472090 CCTCACCCCTGCTGTGTATTGAG 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1060788878 9:126472120-126472142 CTGAGCAGCTAGGTATTCCGGGG No data
1060788862_1060788870 -10 Left 1060788862 9:126472068-126472090 CCTCACCCCTGCTGTGTATTGAG 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1060788870 9:126472081-126472103 GTGTATTGAGACGTTGGGGAGGG No data
1060788862_1060788876 27 Left 1060788862 9:126472068-126472090 CCTCACCCCTGCTGTGTATTGAG 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1060788876 9:126472118-126472140 CTCTGAGCAGCTAGGTATTCCGG No data
1060788862_1060788872 -3 Left 1060788862 9:126472068-126472090 CCTCACCCCTGCTGTGTATTGAG 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1060788872 9:126472088-126472110 GAGACGTTGGGGAGGGATAAGGG No data
1060788862_1060788871 -4 Left 1060788862 9:126472068-126472090 CCTCACCCCTGCTGTGTATTGAG 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1060788871 9:126472087-126472109 TGAGACGTTGGGGAGGGATAAGG No data
1060788862_1060788877 28 Left 1060788862 9:126472068-126472090 CCTCACCCCTGCTGTGTATTGAG 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1060788877 9:126472119-126472141 TCTGAGCAGCTAGGTATTCCGGG No data
1060788862_1060788873 1 Left 1060788862 9:126472068-126472090 CCTCACCCCTGCTGTGTATTGAG 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1060788873 9:126472092-126472114 CGTTGGGGAGGGATAAGGGTTGG No data
1060788862_1060788875 19 Left 1060788862 9:126472068-126472090 CCTCACCCCTGCTGTGTATTGAG 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1060788875 9:126472110-126472132 GTTGGCGGCTCTGAGCAGCTAGG No data
1060788862_1060788874 4 Left 1060788862 9:126472068-126472090 CCTCACCCCTGCTGTGTATTGAG 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1060788874 9:126472095-126472117 TGGGGAGGGATAAGGGTTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060788862 Original CRISPR CTCAATACACAGCAGGGGTG AGG (reversed) Intronic
900751725 1:4401881-4401903 TTCCAAACACAGCAGGGCTGAGG - Intergenic
901255076 1:7817367-7817389 CTAAACACACGGAAGGGGTGGGG + Intronic
901416538 1:9120460-9120482 CTCAGGACAGAGCAGGGCTGGGG + Intronic
903373892 1:22853856-22853878 CTCAACAGATGGCAGGGGTGGGG + Intronic
903932656 1:26872460-26872482 CTCCCCACACAGCAGGGATGAGG - Intergenic
904491020 1:30859146-30859168 CATAACACCCAGCAGGGGTGGGG - Intergenic
905358297 1:37400423-37400445 CTCAATAAACAGGAGTGGAGTGG + Intergenic
906316696 1:44791086-44791108 CTCACAAAATAGCAGGGGTGGGG - Intergenic
909193936 1:72592449-72592471 CTCAATATACAGCAGTGGATTGG + Intergenic
911181303 1:94862965-94862987 CCCCACACACAGCAGGGGAGAGG + Intronic
912002606 1:104853750-104853772 TTCAATACACAGCATGGCTATGG - Intergenic
913191360 1:116416007-116416029 CTCAGGACACAGAAGGGTTGGGG + Intergenic
914445137 1:147743901-147743923 TTGAATACTCAGCAGTGGTGTGG + Intergenic
914847743 1:151292247-151292269 CTCAGTACACTGGAGGGCTGTGG + Exonic
917641814 1:176990220-176990242 GTGAAAGCACAGCAGGGGTGGGG + Intronic
920404821 1:205701321-205701343 AGCTGTACACAGCAGGGGTGGGG + Intergenic
922439986 1:225646930-225646952 ATCAAAACAAAGCAGGGCTGGGG + Intronic
923897771 1:238291997-238292019 CTCAATAGACAGGAAGGGTAAGG - Intergenic
1063429686 10:5977671-5977693 CTCCTTCCCCAGCAGGGGTGGGG - Intronic
1064799088 10:19048582-19048604 CTAAATAAACAGCAGGGGAGAGG - Intergenic
1066427481 10:35321375-35321397 CTGAAATCCCAGCAGGGGTGGGG + Intronic
1067081133 10:43212777-43212799 CTCAATACACCTCAGGGGAGAGG + Intronic
1067259262 10:44673709-44673731 GTGCATACACAGCAGGGGAGGGG - Intergenic
1069821491 10:71231243-71231265 CTAAAAATACAGTAGGGGTGAGG + Intronic
1069879102 10:71580745-71580767 CTCATTACCCAACAGGGGTTTGG - Intronic
1070025412 10:72627033-72627055 CTATTTCCACAGCAGGGGTGAGG - Intergenic
1073608064 10:104915500-104915522 CTCCACACAGAGCTGGGGTGGGG + Intronic
1075508529 10:123048602-123048624 ATCAATAGACAGAAGGGGTCAGG + Intronic
1076295462 10:129380475-129380497 CTGAATCCACAGCAGAGATGCGG + Intergenic
1076856669 10:133119140-133119162 CTCAAGTCACAGCACAGGTGAGG + Intronic
1077333928 11:1995008-1995030 CGCAGCACACACCAGGGGTGGGG - Intergenic
1082095085 11:48123405-48123427 ATCATTTCACAGCAGGGCTGGGG - Intronic
1086153730 11:83642367-83642389 CTGAAAACAGAGAAGGGGTGAGG - Intronic
1086542703 11:87931925-87931947 GACAATGCACAGGAGGGGTGGGG + Intergenic
1086850732 11:91804421-91804443 CTGATCACACAGCAGGGGAGAGG + Intergenic
1089365808 11:117920280-117920302 CCCAATACACAGTGAGGGTGTGG + Intronic
1202816911 11_KI270721v1_random:50190-50212 CGCAGCACACACCAGGGGTGGGG - Intergenic
1091406225 12:211129-211151 CTCAATACCCCTCAGAGGTGAGG - Intronic
1091448964 12:561021-561043 CTATATACACATCAGAGGTGGGG - Intronic
1091685615 12:2559546-2559568 CTCAATACACCGCAGTAATGCGG + Intronic
1092288410 12:7143294-7143316 CTCACTTGACAGCAGTGGTGAGG - Exonic
1096424235 12:51487611-51487633 CAGAGTACACTGCAGGGGTGGGG + Intronic
1096517031 12:52162367-52162389 GTCAAACCACAGCGGGGGTGGGG + Intergenic
1098454950 12:70661647-70661669 CTCCAAACCCAGCACGGGTGAGG + Intronic
1098478944 12:70939161-70939183 CTTAATATGCAGGAGGGGTGGGG - Intergenic
1102199025 12:111044731-111044753 CTGAATCCACAGGAGGGATGAGG + Intronic
1103318675 12:120077397-120077419 CTCCACACACACCAGAGGTGAGG - Intronic
1104689728 12:130816352-130816374 GCCGTTACACAGCAGGGGTGGGG + Intronic
1106694241 13:32154154-32154176 CTCAAGACACAGCAATGTTGTGG - Intronic
1107421733 13:40253785-40253807 CCCAATCCACACCAGGGGTTGGG - Intergenic
1107631161 13:42344047-42344069 CACAACACAGACCAGGGGTGAGG + Intergenic
1107731715 13:43355749-43355771 CTCTTTACAGAGCTGGGGTGGGG - Intronic
1112061698 13:95746863-95746885 CTGATTACTCAGCTGGGGTGAGG + Intronic
1113400566 13:109988929-109988951 CTCCAGACACAGCACAGGTGTGG + Intergenic
1113507870 13:110829666-110829688 CTCGATACACACCAGGGCTGGGG - Intergenic
1114484405 14:23054443-23054465 CTCCAGACACTGTAGGGGTGGGG + Intronic
1115288942 14:31748905-31748927 ATAAAAACAAAGCAGGGGTGGGG - Intronic
1115549365 14:34491179-34491201 CTCATTGCACAACAAGGGTGTGG - Intergenic
1117744960 14:58860308-58860330 CTGAATACACACCAGTGGCGAGG - Intergenic
1119866997 14:77982185-77982207 CTCAAAAAAAAGCAGGGATGGGG - Intergenic
1120122606 14:80700253-80700275 CTCATTACAGAGTAGGGGTTGGG - Intronic
1120535112 14:85685265-85685287 ATCAATATACTGCAGGAGTGGGG - Intergenic
1120788212 14:88555622-88555644 ATCTTTGCACAGCAGGGGTGGGG + Intergenic
1122812829 14:104297462-104297484 CTGAAGGCAAAGCAGGGGTGGGG - Intergenic
1123632448 15:22271407-22271429 CCCAAAACAGAGTAGGGGTGAGG - Intergenic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1124525697 15:30450140-30450162 GACAATTCAAAGCAGGGGTGGGG - Intergenic
1124772958 15:32557545-32557567 GACAATTCAAAGCAGGGGTGGGG + Intergenic
1131274028 15:90965535-90965557 CTCTCTACACATCAGGGGTTAGG + Intergenic
1132942998 16:2517572-2517594 CCCAGCACTCAGCAGGGGTGAGG - Intronic
1134466953 16:14487308-14487330 ATAAATACACAGCAGGCATGTGG - Intronic
1135567625 16:23524098-23524120 CACATTACACAGCAGAGGTTTGG - Exonic
1136364899 16:29805508-29805530 GTAAATACACCGCTGGGGTGGGG + Intergenic
1137066918 16:35856363-35856385 ATCAATACACAGTTGGGATGAGG + Intergenic
1141303384 16:82838448-82838470 GTCAATAAACAGGAAGGGTGTGG - Intronic
1141970524 16:87478973-87478995 CCCAAAACAGAGTAGGGGTGAGG + Intronic
1142229433 16:88892912-88892934 CTTCACACCCAGCAGGGGTGCGG + Intronic
1143622698 17:8089966-8089988 CTGAACACACAGTAGGGGTTCGG - Intergenic
1146125179 17:30225715-30225737 GTCATTCCACAGCAGAGGTGGGG - Intronic
1146522264 17:33535075-33535097 CTCAAGGCAGAGCTGGGGTGGGG + Intronic
1151170214 17:72239398-72239420 CTCAAGGCACAGCTGGGGTGGGG + Intergenic
1152177821 17:78799397-78799419 CCCAAGACACAGCATGTGTGGGG + Intronic
1152901963 17:82947441-82947463 CTCACTCCATTGCAGGGGTGGGG - Intronic
1203160107 17_GL000205v2_random:41534-41556 CTCCAGACAAAGCGGGGGTGCGG + Intergenic
1157263062 18:46193285-46193307 CTAAAAAAAAAGCAGGGGTGGGG - Intronic
1157299207 18:46467609-46467631 CACAGTAGACAGCAGGGATGAGG + Intergenic
1157455618 18:47826289-47826311 TTAAATACAAAGCAAGGGTGTGG + Exonic
1157866184 18:51187079-51187101 CTTAATATGCAGAAGGGGTGGGG - Intronic
1158176044 18:54657026-54657048 CTCATGAAACAGCAAGGGTGGGG - Intergenic
1158734726 18:60066647-60066669 CTCCATAGACAGCAGGCCTGAGG + Intergenic
1158820582 18:61154131-61154153 CAGAATAAACAGCCGGGGTGGGG + Intergenic
1159897611 18:74011949-74011971 CTCAGTGCCCTGCAGGGGTGGGG + Intergenic
1159948162 18:74458618-74458640 CTCAATCAACAGCAGGGTTTGGG + Intergenic
1162567443 19:11451955-11451977 CCCAAGAGACAGCAGGGGAGAGG + Exonic
1164616455 19:29669434-29669456 CTCAGCACACAGCTGGGCTGGGG + Intronic
1165119291 19:33548779-33548801 CTGAAGCCACAGCAGGGATGGGG + Intergenic
1165622578 19:37260610-37260632 TCCAATAGACATCAGGGGTGTGG - Intergenic
1166326657 19:42054882-42054904 ATCTATACACAGCTTGGGTGTGG + Intronic
1166947979 19:46408841-46408863 CTCAGAAAAGAGCAGGGGTGGGG + Intergenic
925006238 2:445034-445056 CTTAATTCACGGCAGGAGTGAGG + Intergenic
926997764 2:18756704-18756726 CTCATTTCACAGCAAGGGTTAGG - Intergenic
927709282 2:25314946-25314968 CTCAGGCCACAGCTGGGGTGGGG + Intronic
929281653 2:40087027-40087049 CTCTAGACACACCTGGGGTGGGG - Intergenic
932420983 2:71601212-71601234 CTCATTTTACAGCAGGGGAGTGG - Intronic
934857764 2:97739593-97739615 CTCCACACACAGCTGGGCTGTGG + Exonic
935857234 2:107288409-107288431 CTCAATAGCCACCAGGGGCGGGG + Intergenic
940462986 2:153991335-153991357 CTGAATAGACAGCTGGAGTGAGG + Intronic
943904518 2:193480722-193480744 CTCAAGGGAGAGCAGGGGTGTGG + Intergenic
945950014 2:216030288-216030310 CTCAGTACAGGGCAGGGGTCGGG + Intronic
946154719 2:217799984-217800006 ATAAATACACAGCTGGGGTGGGG + Exonic
946371891 2:219286086-219286108 CTCTACACTCAGCATGGGTGAGG - Exonic
948659634 2:239499071-239499093 CTCACCGCACAGCAGTGGTGTGG + Intergenic
948791178 2:240377627-240377649 CTCAAAAAGCAGCAGGGGTGGGG + Intergenic
1169388302 20:5169320-5169342 CTCAGTACCCACCAGGAGTGAGG + Intronic
1171186783 20:23128623-23128645 CTCAGCACAGAGCAGGGGTAAGG - Intergenic
1173646872 20:44638873-44638895 CACAACACAAGGCAGGGGTGCGG + Intronic
1178948759 21:36968793-36968815 CTCCATACCTAGCAGGGGTGGGG - Intronic
1182633155 22:31703109-31703131 CTTAAAACACAGCAGGGGCCAGG - Intronic
1183010709 22:34944379-34944401 CTGTTTACACAGCAGGGGTTGGG - Intergenic
1183639449 22:39084160-39084182 CTCAGAGCACAGCAGGAGTGGGG - Intronic
1184287356 22:43479083-43479105 CTCAACAGACAGCTGGGGAGGGG - Intronic
949332133 3:2934243-2934265 CTGATTACACTGCAGGGGTCAGG - Intronic
949735713 3:7169474-7169496 CTAAAAACACAGAAGGGATGTGG + Intronic
949881645 3:8665726-8665748 CTCAAAACAAAGCAAGGCTGTGG + Intronic
955079832 3:55648467-55648489 CTCAATAAACAGCAGGCATTAGG + Intronic
955358331 3:58250476-58250498 CTCAATTCACACCAGGGATCAGG - Intronic
957902414 3:86512051-86512073 TTCAATTTACACCAGGGGTGGGG + Intergenic
959982093 3:112528249-112528271 CTCAATATCCAGCAGGTGAGAGG + Intergenic
960996238 3:123342431-123342453 CTCCCCACACATCAGGGGTGGGG - Intronic
962702021 3:138009578-138009600 CTCTAAAAACGGCAGGGGTGGGG - Intronic
965095141 3:164216431-164216453 ATCAATACATAGTAGGGATGAGG - Intergenic
967761299 3:193228783-193228805 CACAAGACGCACCAGGGGTGTGG - Intergenic
967860293 3:194146166-194146188 CCCAATACACATCTGGGGTGGGG + Intergenic
968957692 4:3727520-3727542 ATAATTACTCAGCAGGGGTGGGG + Intergenic
969009640 4:4051238-4051260 CTCAATGAACAGCAGGCCTGGGG + Intergenic
975034958 4:69668764-69668786 CTCACTCCACAGCAGCAGTGTGG + Intergenic
983552521 4:169032177-169032199 CTGAAATCACAGCAGGGCTGGGG + Intergenic
987789398 5:22545224-22545246 CTCAATACCCATCAATGGTGGGG + Intronic
1001323018 5:170698413-170698435 GTTAATAAACAGCAGAGGTGGGG - Intronic
1002764510 6:227436-227458 CTCATCACACAGGAGGAGTGTGG + Intergenic
1003629549 6:7774158-7774180 CTCAATCCACGGCAGGGTTTGGG + Intronic
1004982252 6:21038396-21038418 CTGAGCACACAGCAGGGCTGGGG + Intronic
1006436999 6:34030921-34030943 CCCTGTACACAGCAGGAGTGGGG + Intronic
1006527851 6:34623398-34623420 CTCAAAACTGACCAGGGGTGGGG - Intronic
1006751558 6:36381049-36381071 CCCAGTAAACTGCAGGGGTGTGG - Intronic
1007193302 6:40038258-40038280 TTCAATTGACAGAAGGGGTGAGG - Intergenic
1007710077 6:43817326-43817348 CTGATGACACAGCACGGGTGGGG + Intergenic
1007796253 6:44350362-44350384 CTAAATGAAGAGCAGGGGTGAGG + Intronic
1009532130 6:64830943-64830965 CTCATTGCACAGCAGAGGGGAGG - Intronic
1010316113 6:74452340-74452362 CAGAACACACAACAGGGGTGTGG - Intergenic
1010580630 6:77592899-77592921 GTCAATACATTGCAGGGCTGGGG - Intergenic
1013255416 6:108380043-108380065 ATCTTTACACAGGAGGGGTGGGG + Intronic
1016448515 6:144157157-144157179 CACAATACACAGTAGGAGAGAGG + Intronic
1019029003 6:168994539-168994561 CAAAATACAGAGCAGGGGAGTGG + Intergenic
1019814885 7:3192380-3192402 CTCCTTCCAGAGCAGGGGTGGGG + Intergenic
1020958671 7:14775731-14775753 CTCAAAATTCAGCAGGGCTGGGG - Intronic
1023059856 7:36316581-36316603 CACAATACACAGCAGGCCTGGGG - Intergenic
1028458948 7:91070085-91070107 CACAATACACAGGCTGGGTGTGG - Intronic
1031910778 7:127514676-127514698 TACAATACACAGCAGGGTTTGGG - Intergenic
1034920254 7:155073643-155073665 CTGAATAAACATCAGGGGAGAGG - Intronic
1035534576 8:381391-381413 ATCAATGCCGAGCAGGGGTGCGG + Intergenic
1035707013 8:1683507-1683529 CTCAAATGACAGCAGAGGTGCGG - Intronic
1037831254 8:22190955-22190977 CTGAATACACAGCAGGCTTTGGG + Intronic
1040957182 8:52991329-52991351 TTCAATACACACCAGGGATCTGG - Intergenic
1041113112 8:54506315-54506337 CTCAGTGCACAGTAGGAGTGAGG + Intergenic
1047566229 8:126047007-126047029 ATCAATACACAGGAAGGGTTGGG + Intergenic
1049374217 8:142281391-142281413 ACCAAAACACAGCAGGGATGGGG + Intronic
1049560189 8:143306476-143306498 CTCAGGACACAGCAGGGTGGGGG - Intronic
1050301102 9:4259715-4259737 CTCTATTCACAGATGGGGTGGGG + Intronic
1055524618 9:77118185-77118207 CCTAATATACAGCATGGGTGAGG + Intergenic
1056557082 9:87698494-87698516 CACAGTGCACAGCAGGCGTGGGG + Intronic
1056765801 9:89443725-89443747 CTCCCTCCACAGCATGGGTGGGG + Intronic
1056967634 9:91178397-91178419 CTCAGCAGCCAGCAGGGGTGTGG + Intergenic
1057227822 9:93301804-93301826 CACAAAACACAGCATGGGGGTGG - Intronic
1058744551 9:107976960-107976982 CTGAAGCCACAGCAGTGGTGAGG - Intergenic
1060717231 9:125943856-125943878 CTCAAGACAGAGGAGGTGTGTGG + Intronic
1060788862 9:126472068-126472090 CTCAATACACAGCAGGGGTGAGG - Intronic
1060922941 9:127435426-127435448 CTCATTTCGCAGGAGGGGTGGGG + Intronic
1061213317 9:129206047-129206069 CTCAATACACAGTATGGGCGAGG + Intergenic
1061956391 9:133963558-133963580 CTTTCTACACAGCAGGGCTGTGG + Intronic
1195274335 X:103266747-103266769 GGCTTTACACAGCAGGGGTGTGG - Intergenic
1198774376 X:140163992-140164014 CTTAATACTGAGCAGGGGTCTGG + Intergenic
1200118034 X:153777704-153777726 CCATATGCACAGCAGGGGTGGGG - Intronic