ID: 1060789109

View in Genome Browser
Species Human (GRCh38)
Location 9:126473866-126473888
Sequence CCTGTTCACCACCTTGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060789106_1060789109 17 Left 1060789106 9:126473826-126473848 CCACGTTAAGTGGTAATGTTGAG 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1060789109 9:126473866-126473888 CCTGTTCACCACCTTGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060789109 Original CRISPR CCTGTTCACCACCTTGTGTA TGG Intronic
No off target data available for this crispr